2mo6

From Proteopedia

Revision as of 05:37, 30 April 2014 (edit) OCA (Talk | contribs) (New page: '''Unreleased structure''' The entry 2mo6 is ON HOLD until sometime in the future Authors: Webba da Silva, M., Dvorkin, S.A., Karsisiotis, A.I. Description: G-quadruplex solution struc...) ← Previous diff

Revision as of 05:37, 30 April 2014 (edit) (undo) OCA (Talk | contribs) m (Protected "2mo6" [edit=sysop:move=sysop]) Next diff →

---

Revision as of 05:37, 30 April 2014

proteopedia linkproteopedia link

Unreleased structure

The entry 2mo6 is ON HOLD until sometime in the future

Authors: Webba da Silva, M., Dvorkin, S.A., Karsisiotis, A.I.

Description: G-quadruplex solution structure formed by the sequence d(GGGTTTTGGGTTTTGGGAGGG) in sodium solution