This old version of Proteopedia is provided for student assignments while the new version is undergoing repairs. Content and edits done in this old version of Proteopedia after March 1, 2026 will eventually be lost when it is retired in about June of 2026.


Apply for new accounts at the new Proteopedia. Your logins will work in both the old and new versions.


2mo6

From Proteopedia

(Difference between revisions)
Jump to: navigation, search
m (Protected "2mo6" [edit=sysop:move=sysop])
Line 6: Line 6:
Description: G-quadruplex solution structure formed by the sequence d(GGGTTTTGGGTTTTGGGAGGG) in sodium solution
Description: G-quadruplex solution structure formed by the sequence d(GGGTTTTGGGTTTTGGGAGGG) in sodium solution
 +
[[Category: Unreleased Structures]]
 +
[[Category: Karsisiotis, A.I]]
 +
[[Category: Dvorkin, S.A]]
 +
[[Category: Webba Da Silva, M]]

Revision as of 12:13, 24 December 2014

Unreleased structure

The entry 2mo6 is ON HOLD until sometime in the future

Authors: Webba da Silva, M., Dvorkin, S.A., Karsisiotis, A.I.

Description: G-quadruplex solution structure formed by the sequence d(GGGTTTTGGGTTTTGGGAGGG) in sodium solution

Proteopedia Page Contributors and Editors (what is this?)

OCA

Personal tools