2mo6
From Proteopedia
(Difference between revisions)
m (Protected "2mo6" [edit=sysop:move=sysop]) |
|||
| Line 6: | Line 6: | ||
Description: G-quadruplex solution structure formed by the sequence d(GGGTTTTGGGTTTTGGGAGGG) in sodium solution | Description: G-quadruplex solution structure formed by the sequence d(GGGTTTTGGGTTTTGGGAGGG) in sodium solution | ||
| + | [[Category: Unreleased Structures]] | ||
| + | [[Category: Karsisiotis, A.I]] | ||
| + | [[Category: Dvorkin, S.A]] | ||
| + | [[Category: Webba Da Silva, M]] | ||
Revision as of 12:13, 24 December 2014
Unreleased structure
The entry 2mo6 is ON HOLD until sometime in the future
Authors: Webba da Silva, M., Dvorkin, S.A., Karsisiotis, A.I.
Description: G-quadruplex solution structure formed by the sequence d(GGGTTTTGGGTTTTGGGAGGG) in sodium solution
