This old version of Proteopedia is provided for student assignments while the new version is undergoing repairs. Content and edits done in this old version of Proteopedia after March 1, 2026 will eventually be lost when it is retired in about June of 2026.
Apply for new accounts at the new Proteopedia. Your logins will work in both the old and new versions.
1qwb
From Proteopedia
(Difference between revisions)
| Line 3: | Line 3: | ||
== Structural highlights == | == Structural highlights == | ||
<table><tr><td colspan='2'>[[1qwb]] is a 1 chain structure. Full experimental information is available from [http://oca.weizmann.ac.il/oca-bin/ocashort?id=1QWB OCA]. For a <b>guided tour on the structure components</b> use [http://oca.weizmann.ac.il/oca-docs/fgij/fg.htm?mol=1QWB FirstGlance]. <br> | <table><tr><td colspan='2'>[[1qwb]] is a 1 chain structure. Full experimental information is available from [http://oca.weizmann.ac.il/oca-bin/ocashort?id=1QWB OCA]. For a <b>guided tour on the structure components</b> use [http://oca.weizmann.ac.il/oca-docs/fgij/fg.htm?mol=1QWB FirstGlance]. <br> | ||
| - | </td></tr><tr><td class="sblockLbl"><b>[[Related_structure|Related:]]</b></td><td class="sblockDat">[[1ie1|1ie1]], [[1ie2|1ie2]], [[1qwa|1qwa]]</td></tr> | + | </td></tr><tr id='related'><td class="sblockLbl"><b>[[Related_structure|Related:]]</b></td><td class="sblockDat">[[1ie1|1ie1]], [[1ie2|1ie2]], [[1qwa|1qwa]]</td></tr> |
| - | <tr><td class="sblockLbl"><b>Resources:</b></td><td class="sblockDat"><span class='plainlinks'>[http://oca.weizmann.ac.il/oca-docs/fgij/fg.htm?mol=1qwb FirstGlance], [http://oca.weizmann.ac.il/oca-bin/ocaids?id=1qwb OCA], [http://www.rcsb.org/pdb/explore.do?structureId=1qwb RCSB], [http://www.ebi.ac.uk/pdbsum/1qwb PDBsum]</span></td></tr> | + | <tr id='resources'><td class="sblockLbl"><b>Resources:</b></td><td class="sblockDat"><span class='plainlinks'>[http://oca.weizmann.ac.il/oca-docs/fgij/fg.htm?mol=1qwb FirstGlance], [http://oca.weizmann.ac.il/oca-bin/ocaids?id=1qwb OCA], [http://www.rcsb.org/pdb/explore.do?structureId=1qwb RCSB], [http://www.ebi.ac.uk/pdbsum/1qwb PDBsum]</span></td></tr> |
| - | <table> | + | </table> |
<div style="background-color:#fffaf0;"> | <div style="background-color:#fffaf0;"> | ||
== Publication Abstract from PubMed == | == Publication Abstract from PubMed == | ||
| Line 18: | Line 18: | ||
__TOC__ | __TOC__ | ||
</StructureSection> | </StructureSection> | ||
| - | [[Category: Feigon, J | + | [[Category: Feigon, J]] |
| - | [[Category: Finger, L D | + | [[Category: Finger, L D]] |
| - | [[Category: Johansson, C | + | [[Category: Johansson, C]] |
| - | [[Category: Trantirek, L | + | [[Category: Trantirek, L]] |
[[Category: A-form helix]] | [[Category: A-form helix]] | ||
[[Category: Disordered hairpin loop]] | [[Category: Disordered hairpin loop]] | ||
Revision as of 05:31, 22 December 2014
NMR strucutre of 5'-r(GGACACGAAAUCCCGAAGUAGUGUCC)-3' : an RNA hairpin containing the in vitro selected consensus sequence for nucleolin RBD12
| |||||||||||
