We apologize for Proteopedia being slow to respond. For the past two years, a new implementation of Proteopedia has been being built. Soon, it will replace this 18-year old system. All existing content will be moved to the new system at a date that will be announced here.

2m6w

From Proteopedia

(Difference between revisions)
Jump to: navigation, search
Line 7: Line 7:
__TOC__
__TOC__
</StructureSection>
</StructureSection>
-
[[Category: Karsisiotis, A I.]]
+
[[Category: Karsisiotis, A I]]
-
[[Category: Silva, M Webba da.]]
+
[[Category: Silva, M Webba da]]
[[Category: Dna]]
[[Category: Dna]]
[[Category: Folding topology]]
[[Category: Folding topology]]
[[Category: G-quadruplex]]
[[Category: G-quadruplex]]

Revision as of 08:14, 25 January 2015

Solution NMR structure of the d(GGGGTTGGGGTTTTGGGGAAGGGG) quadruplex in sodium conditions

Drag the structure with the mouse to rotate

Proteopedia Page Contributors and Editors (what is this?)

OCA

Personal tools