This old version of Proteopedia is provided for student assignments while the new version is undergoing repairs. Content and edits done in this old version of Proteopedia after March 1, 2026 will eventually be lost when it is retired in about June of 2026.


Apply for new accounts at the new Proteopedia. Your logins will work in both the old and new versions.


1qwa

From Proteopedia

(Difference between revisions)
Jump to: navigation, search
Line 4: Line 4:
<table><tr><td colspan='2'>[[1qwa]] is a 1 chain structure. Full experimental information is available from [http://oca.weizmann.ac.il/oca-bin/ocashort?id=1QWA OCA]. For a <b>guided tour on the structure components</b> use [http://oca.weizmann.ac.il/oca-docs/fgij/fg.htm?mol=1QWA FirstGlance]. <br>
<table><tr><td colspan='2'>[[1qwa]] is a 1 chain structure. Full experimental information is available from [http://oca.weizmann.ac.il/oca-bin/ocashort?id=1QWA OCA]. For a <b>guided tour on the structure components</b> use [http://oca.weizmann.ac.il/oca-docs/fgij/fg.htm?mol=1QWA FirstGlance]. <br>
</td></tr><tr id='related'><td class="sblockLbl"><b>[[Related_structure|Related:]]</b></td><td class="sblockDat">[[1f7y|1f7y]], [[1jp0|1jp0]], [[1f7f|1f7f]], [[1qwb|1qwb]]</td></tr>
</td></tr><tr id='related'><td class="sblockLbl"><b>[[Related_structure|Related:]]</b></td><td class="sblockDat">[[1f7y|1f7y]], [[1jp0|1jp0]], [[1f7f|1f7f]], [[1qwb|1qwb]]</td></tr>
-
<tr id='resources'><td class="sblockLbl"><b>Resources:</b></td><td class="sblockDat"><span class='plainlinks'>[http://oca.weizmann.ac.il/oca-docs/fgij/fg.htm?mol=1qwa FirstGlance], [http://oca.weizmann.ac.il/oca-bin/ocaids?id=1qwa OCA], [http://www.rcsb.org/pdb/explore.do?structureId=1qwa RCSB], [http://www.ebi.ac.uk/pdbsum/1qwa PDBsum]</span></td></tr>
+
<tr id='resources'><td class="sblockLbl"><b>Resources:</b></td><td class="sblockDat"><span class='plainlinks'>[http://oca.weizmann.ac.il/oca-docs/fgij/fg.htm?mol=1qwa FirstGlance], [http://oca.weizmann.ac.il/oca-bin/ocaids?id=1qwa OCA], [http://pdbe.org/1qwa PDBe], [http://www.rcsb.org/pdb/explore.do?structureId=1qwa RCSB], [http://www.ebi.ac.uk/pdbsum/1qwa PDBsum]</span></td></tr>
</table>
</table>
<div style="background-color:#fffaf0;">
<div style="background-color:#fffaf0;">
Line 14: Line 14:
From MEDLINE&reg;/PubMed&reg;, a database of the U.S. National Library of Medicine.<br>
From MEDLINE&reg;/PubMed&reg;, a database of the U.S. National Library of Medicine.<br>
</div>
</div>
 +
<div class="pdbe-citations 1qwa" style="background-color:#fffaf0;"></div>
== References ==
== References ==
<references/>
<references/>

Revision as of 14:46, 11 September 2015

NMR structure of 5'-r(GGAUGCCUCCCGAGUGCAUCC): an RNA hairpin derived from the mouse 5'ETS that binds nucleolin RBD12.

Drag the structure with the mouse to rotate

Proteopedia Page Contributors and Editors (what is this?)

OCA

Personal tools