We apologize for Proteopedia being slow to respond. For the past two years, a new implementation of Proteopedia has been being built. Soon, it will replace this 18-year old system. All existing content will be moved to the new system at a date that will be announced here.

5e3n

From Proteopedia

(Difference between revisions)
Jump to: navigation, search
Line 1: Line 1:
-
'''Unreleased structure'''
 
-
The entry 5e3n is ON HOLD until Paper Publication
+
==Crystal structure of Fis bound to 27bp DNA F31 (AAATTTGTAGGAATTTTCTGCAAATTT)==
-
 
+
<StructureSection load='5e3n' size='340' side='right' caption='[[5e3n]], [[Resolution|resolution]] 2.66&Aring;' scene=''>
-
Authors: Hancock, S.P., Cascio, D., Johnson, R.C.
+
== Structural highlights ==
-
 
+
<table><tr><td colspan='2'>[[5e3n]] is a 4 chain structure. Full crystallographic information is available from [http://oca.weizmann.ac.il/oca-bin/ocashort?id=5E3N OCA]. For a <b>guided tour on the structure components</b> use [http://oca.weizmann.ac.il/oca-docs/fgij/fg.htm?mol=5E3N FirstGlance]. <br>
-
Description: Crystal structure of Fis bound to 27bp DNA F31 (AAATTTGTAGGAATTTTCTGCAAATTT)
+
</td></tr><tr id='related'><td class="sblockLbl"><b>[[Related_structure|Related:]]</b></td><td class="sblockDat">[[5e3l|5e3l]], [[5e3o|5e3o]], [[5e3m|5e3m]], [[5ds9|5ds9]], [[5dtd|5dtd]]</td></tr>
-
[[Category: Unreleased Structures]]
+
<tr id='resources'><td class="sblockLbl"><b>Resources:</b></td><td class="sblockDat"><span class='plainlinks'>[http://oca.weizmann.ac.il/oca-docs/fgij/fg.htm?mol=5e3n FirstGlance], [http://oca.weizmann.ac.il/oca-bin/ocaids?id=5e3n OCA], [http://pdbe.org/5e3n PDBe], [http://www.rcsb.org/pdb/explore.do?structureId=5e3n RCSB], [http://www.ebi.ac.uk/pdbsum/5e3n PDBsum]</span></td></tr>
-
[[Category: Hancock, S.P]]
+
</table>
-
[[Category: Johnson, R.C]]
+
== Function ==
 +
[[http://www.uniprot.org/uniprot/FIS_ECOLI FIS_ECOLI]] Activates ribosomal RNA transcription, as well other genes. Plays a direct role in upstream activation of rRNA promoters. Binds to a recombinational enhancer sequence that is required to stimulate hin-mediated DNA inversion. Prevents initiation of DNA replication from oriC.<ref>PMID:2209559</ref> <ref>PMID:8836178</ref>
 +
== References ==
 +
<references/>
 +
__TOC__
 +
</StructureSection>
[[Category: Cascio, D]]
[[Category: Cascio, D]]
 +
[[Category: Hancock, S P]]
 +
[[Category: Johnson, R C]]
 +
[[Category: Dna bending]]
 +
[[Category: Dna binding protein-dna complex]]
 +
[[Category: Hth domain]]
 +
[[Category: Indirect recognition]]
 +
[[Category: Protein-dna complex]]

Revision as of 03:55, 10 March 2016

Crystal structure of Fis bound to 27bp DNA F31 (AAATTTGTAGGAATTTTCTGCAAATTT)

5e3n, resolution 2.66Å

Drag the structure with the mouse to rotate

Proteopedia Page Contributors and Editors (what is this?)

OCA

Personal tools