We apologize for Proteopedia being slow to respond. For the past two years, a new implementation of Proteopedia has been being built. Soon, it will replace this 18-year old system. All existing content will be moved to the new system at a date that will be announced here.

5e3m

From Proteopedia

(Difference between revisions)
Jump to: navigation, search
Line 1: Line 1:
'''Unreleased structure'''
'''Unreleased structure'''
-
The entry 5e3m is ON HOLD
+
The entry 5e3m is ON HOLD until Paper Publication
Authors: Stella, S., Hancock, S.P., Cascio, D., Johnson, R.C.
Authors: Stella, S., Hancock, S.P., Cascio, D., Johnson, R.C.

Revision as of 13:55, 26 February 2016

Unreleased structure

The entry 5e3m is ON HOLD until Paper Publication

Authors: Stella, S., Hancock, S.P., Cascio, D., Johnson, R.C.

Description: Crystal structure of Fis bound to 27bp DNA F35 (AAATTAGTTTGAATCTCGAGCTAATTT)

Proteopedia Page Contributors and Editors (what is this?)

OCA

Personal tools