This old version of Proteopedia is provided for student assignments while the new version is undergoing repairs. Content and edits done in this old version of Proteopedia after March 1, 2026 will eventually be lost when it is retired in about June of 2026.


Apply for new accounts at the new Proteopedia. Your logins will work in both the old and new versions.


1qwa

From Proteopedia

(Difference between revisions)
Jump to: navigation, search
Line 1: Line 1:
==NMR structure of 5'-r(GGAUGCCUCCCGAGUGCAUCC): an RNA hairpin derived from the mouse 5'ETS that binds nucleolin RBD12.==
==NMR structure of 5'-r(GGAUGCCUCCCGAGUGCAUCC): an RNA hairpin derived from the mouse 5'ETS that binds nucleolin RBD12.==
-
<StructureSection load='1qwa' size='340' side='right'caption='[[1qwa]], [[NMR_Ensembles_of_Models | 17 NMR models]]' scene=''>
+
<StructureSection load='1qwa' size='340' side='right'caption='[[1qwa]]' scene=''>
== Structural highlights ==
== Structural highlights ==
-
<table><tr><td colspan='2'>[[1qwa]] is a 1 chain structure. Full experimental information is available from [http://oca.weizmann.ac.il/oca-bin/ocashort?id=1QWA OCA]. For a <b>guided tour on the structure components</b> use [https://proteopedia.org/fgij/fg.htm?mol=1QWA FirstGlance]. <br>
+
<table><tr><td colspan='2'>[[1qwa]] is a 1 chain structure with sequence from [https://en.wikipedia.org/wiki/Mus_musculus Mus musculus]. Full experimental information is available from [http://oca.weizmann.ac.il/oca-bin/ocashort?id=1QWA OCA]. For a <b>guided tour on the structure components</b> use [https://proteopedia.org/fgij/fg.htm?mol=1QWA FirstGlance]. <br>
-
</td></tr><tr id='related'><td class="sblockLbl"><b>[[Related_structure|Related:]]</b></td><td class="sblockDat"><div style='overflow: auto; max-height: 3em;'>[[1f7y|1f7y]], [[1jp0|1jp0]], [[1f7f|1f7f]], [[1qwb|1qwb]]</div></td></tr>
+
</td></tr><tr id='resources'><td class="sblockLbl"><b>Resources:</b></td><td class="sblockDat"><span class='plainlinks'>[https://proteopedia.org/fgij/fg.htm?mol=1qwa FirstGlance], [http://oca.weizmann.ac.il/oca-bin/ocaids?id=1qwa OCA], [https://pdbe.org/1qwa PDBe], [https://www.rcsb.org/pdb/explore.do?structureId=1qwa RCSB], [https://www.ebi.ac.uk/pdbsum/1qwa PDBsum], [https://prosat.h-its.org/prosat/prosatexe?pdbcode=1qwa ProSAT]</span></td></tr>
-
<tr id='resources'><td class="sblockLbl"><b>Resources:</b></td><td class="sblockDat"><span class='plainlinks'>[https://proteopedia.org/fgij/fg.htm?mol=1qwa FirstGlance], [http://oca.weizmann.ac.il/oca-bin/ocaids?id=1qwa OCA], [https://pdbe.org/1qwa PDBe], [https://www.rcsb.org/pdb/explore.do?structureId=1qwa RCSB], [https://www.ebi.ac.uk/pdbsum/1qwa PDBsum], [https://prosat.h-its.org/prosat/prosatexe?pdbcode=1qwa ProSAT]</span></td></tr>
+
</table>
</table>
<div style="background-color:#fffaf0;">
<div style="background-color:#fffaf0;">
Line 21: Line 20:
</StructureSection>
</StructureSection>
[[Category: Large Structures]]
[[Category: Large Structures]]
-
[[Category: Feigon, J]]
+
[[Category: Mus musculus]]
-
[[Category: Finger, L D]]
+
[[Category: Feigon J]]
-
[[Category: Johansson, C]]
+
[[Category: Finger LD]]
-
[[Category: Trantirek, L]]
+
[[Category: Johansson C]]
-
[[Category: A-form helix]]
+
[[Category: Trantirek L]]
-
[[Category: Bulged nucleotide]]
+
-
[[Category: Hairpin]]
+
-
[[Category: Rna]]
+
-
[[Category: Tetraloop]]
+
-
[[Category: Uncg]]
+
-
[[Category: Uucg]]
+
-
[[Category: Ynmg]]
+

Revision as of 08:06, 11 January 2023

NMR structure of 5'-r(GGAUGCCUCCCGAGUGCAUCC): an RNA hairpin derived from the mouse 5'ETS that binds nucleolin RBD12.

PDB ID 1qwa

Drag the structure with the mouse to rotate

Proteopedia Page Contributors and Editors (what is this?)

OCA

Personal tools