We apologize for Proteopedia being slow to respond. For the past two years, a new implementation of Proteopedia has been being built. Soon, it will replace this 18-year old system. All existing content will be moved to the new system at a date that will be announced here.

2m8z

From Proteopedia

(Difference between revisions)
Jump to: navigation, search
Line 1: Line 1:
==Structure of d[GGTTGGCGCGAAGCATTCGCGGGTTGG] quadruplex-duplex hybrid==
==Structure of d[GGTTGGCGCGAAGCATTCGCGGGTTGG] quadruplex-duplex hybrid==
-
<StructureSection load='2m8z' size='340' side='right'caption='[[2m8z]], [[NMR_Ensembles_of_Models | 10 NMR models]]' scene=''>
+
<StructureSection load='2m8z' size='340' side='right'caption='[[2m8z]]' scene=''>
== Structural highlights ==
== Structural highlights ==
-
<table><tr><td colspan='2'>[[2m8z]] is a 1 chain structure. Full experimental information is available from [http://oca.weizmann.ac.il/oca-bin/ocashort?id=2M8Z OCA]. For a <b>guided tour on the structure components</b> use [https://proteopedia.org/fgij/fg.htm?mol=2M8Z FirstGlance]. <br>
+
<table><tr><td colspan='2'>Full crystallographic information is available from [http://oca.weizmann.ac.il/oca-bin/ocashort?id=2M8Z OCA]. For a <b>guided tour on the structure components</b> use [https://proteopedia.org/fgij/fg.htm?mol=2M8Z FirstGlance]. <br>
-
</td></tr><tr id='related'><td class="sblockLbl"><b>[[Related_structure|Related:]]</b></td><td class="sblockDat"><div style='overflow: auto; max-height: 3em;'>[[2m8y|2m8y]], [[2m90|2m90]], [[2m91|2m91]], [[2m92|2m92]], [[2m93|2m93]]</div></td></tr>
+
</td></tr><tr id='resources'><td class="sblockLbl"><b>Resources:</b></td><td class="sblockDat"><span class='plainlinks'>[https://proteopedia.org/fgij/fg.htm?mol=2m8z FirstGlance], [http://oca.weizmann.ac.il/oca-bin/ocaids?id=2m8z OCA], [https://pdbe.org/2m8z PDBe], [https://www.rcsb.org/pdb/explore.do?structureId=2m8z RCSB], [https://www.ebi.ac.uk/pdbsum/2m8z PDBsum], [https://prosat.h-its.org/prosat/prosatexe?pdbcode=2m8z ProSAT]</span></td></tr>
-
<tr id='resources'><td class="sblockLbl"><b>Resources:</b></td><td class="sblockDat"><span class='plainlinks'>[https://proteopedia.org/fgij/fg.htm?mol=2m8z FirstGlance], [http://oca.weizmann.ac.il/oca-bin/ocaids?id=2m8z OCA], [https://pdbe.org/2m8z PDBe], [https://www.rcsb.org/pdb/explore.do?structureId=2m8z RCSB], [https://www.ebi.ac.uk/pdbsum/2m8z PDBsum], [https://prosat.h-its.org/prosat/prosatexe?pdbcode=2m8z ProSAT]</span></td></tr>
+
</table>
</table>
-
<div style="background-color:#fffaf0;">
 
-
== Publication Abstract from PubMed ==
 
-
Coaxial and orthogonal orientations of the helices (left and right illustration, respectively) in a quadruplex-duplex junction were realized by incorporating a duplex hairpin across the diverse geometries of a quadruplex. The modularity of the approach was validated through the simultaneous attachment of multiple duplex stems onto a G-quadruplex scaffold to generate a G-junction.
 
- 
-
Structural Basis of DNA Quadruplex-Duplex Junction Formation.,Lim KW, Phan AT Angew Chem Int Ed Engl. 2013 Jun 21. doi: 10.1002/anie.201302995. PMID:23794476<ref>PMID:23794476</ref>
 
- 
-
From MEDLINE&reg;/PubMed&reg;, a database of the U.S. National Library of Medicine.<br>
 
-
</div>
 
-
<div class="pdbe-citations 2m8z" style="background-color:#fffaf0;"></div>
 
-
== References ==
 
-
<references/>
 
__TOC__
__TOC__
</StructureSection>
</StructureSection>
[[Category: Large Structures]]
[[Category: Large Structures]]
-
[[Category: Lim, K W]]
+
[[Category: Lim KW]]
-
[[Category: Phan, A T]]
+
[[Category: Phan AT]]
-
[[Category: Dna]]
+
-
[[Category: Duplex]]
+
-
[[Category: Quadruplex]]
+
-
[[Category: Quadruplex-duplex hybrid]]
+

Revision as of 10:20, 31 August 2022

Structure of d[GGTTGGCGCGAAGCATTCGCGGGTTGG] quadruplex-duplex hybrid

PDB ID 2m8z

Drag the structure with the mouse to rotate

Proteopedia Page Contributors and Editors (what is this?)

OCA

Personal tools