2m8z
From Proteopedia
(Difference between revisions)
| Line 1: | Line 1: | ||
==Structure of d[GGTTGGCGCGAAGCATTCGCGGGTTGG] quadruplex-duplex hybrid== | ==Structure of d[GGTTGGCGCGAAGCATTCGCGGGTTGG] quadruplex-duplex hybrid== | ||
| - | <StructureSection load='2m8z' size='340' side='right'caption='[[2m8z | + | <StructureSection load='2m8z' size='340' side='right'caption='[[2m8z]]' scene=''> |
== Structural highlights == | == Structural highlights == | ||
| - | <table><tr><td colspan='2'> | + | <table><tr><td colspan='2'>Full crystallographic information is available from [http://oca.weizmann.ac.il/oca-bin/ocashort?id=2M8Z OCA]. For a <b>guided tour on the structure components</b> use [https://proteopedia.org/fgij/fg.htm?mol=2M8Z FirstGlance]. <br> |
| - | </td></tr> | + | </td></tr><tr id='resources'><td class="sblockLbl"><b>Resources:</b></td><td class="sblockDat"><span class='plainlinks'>[https://proteopedia.org/fgij/fg.htm?mol=2m8z FirstGlance], [http://oca.weizmann.ac.il/oca-bin/ocaids?id=2m8z OCA], [https://pdbe.org/2m8z PDBe], [https://www.rcsb.org/pdb/explore.do?structureId=2m8z RCSB], [https://www.ebi.ac.uk/pdbsum/2m8z PDBsum], [https://prosat.h-its.org/prosat/prosatexe?pdbcode=2m8z ProSAT]</span></td></tr> |
| - | <tr id='resources'><td class="sblockLbl"><b>Resources:</b></td><td class="sblockDat"><span class='plainlinks'>[https://proteopedia.org/fgij/fg.htm?mol=2m8z FirstGlance], [http://oca.weizmann.ac.il/oca-bin/ocaids?id=2m8z OCA], [https://pdbe.org/2m8z PDBe], [https://www.rcsb.org/pdb/explore.do?structureId=2m8z RCSB], [https://www.ebi.ac.uk/pdbsum/2m8z PDBsum], [https://prosat.h-its.org/prosat/prosatexe?pdbcode=2m8z ProSAT]</span></td></tr> | + | |
</table> | </table> | ||
| - | <div style="background-color:#fffaf0;"> | ||
| - | == Publication Abstract from PubMed == | ||
| - | Coaxial and orthogonal orientations of the helices (left and right illustration, respectively) in a quadruplex-duplex junction were realized by incorporating a duplex hairpin across the diverse geometries of a quadruplex. The modularity of the approach was validated through the simultaneous attachment of multiple duplex stems onto a G-quadruplex scaffold to generate a G-junction. | ||
| - | |||
| - | Structural Basis of DNA Quadruplex-Duplex Junction Formation.,Lim KW, Phan AT Angew Chem Int Ed Engl. 2013 Jun 21. doi: 10.1002/anie.201302995. PMID:23794476<ref>PMID:23794476</ref> | ||
| - | |||
| - | From MEDLINE®/PubMed®, a database of the U.S. National Library of Medicine.<br> | ||
| - | </div> | ||
| - | <div class="pdbe-citations 2m8z" style="background-color:#fffaf0;"></div> | ||
| - | == References == | ||
| - | <references/> | ||
__TOC__ | __TOC__ | ||
</StructureSection> | </StructureSection> | ||
[[Category: Large Structures]] | [[Category: Large Structures]] | ||
| - | [[Category: Lim | + | [[Category: Lim KW]] |
| - | [[Category: Phan | + | [[Category: Phan AT]] |
| - | + | ||
| - | + | ||
| - | + | ||
| - | + | ||
Revision as of 10:20, 31 August 2022
Structure of d[GGTTGGCGCGAAGCATTCGCGGGTTGG] quadruplex-duplex hybrid
| |||||||||||
