We apologize for Proteopedia being slow to respond. For the past two years, a new implementation of Proteopedia has been being built. Soon, it will replace this 18-year old system. All existing content will be moved to the new system at a date that will be announced here.

2m6w

From Proteopedia

(Difference between revisions)
Jump to: navigation, search
Line 1: Line 1:
==Solution NMR structure of the d(GGGGTTGGGGTTTTGGGGAAGGGG) quadruplex in sodium conditions==
==Solution NMR structure of the d(GGGGTTGGGGTTTTGGGGAAGGGG) quadruplex in sodium conditions==
-
<StructureSection load='2m6w' size='340' side='right'caption='[[2m6w]], [[NMR_Ensembles_of_Models | 8 NMR models]]' scene=''>
+
<StructureSection load='2m6w' size='340' side='right'caption='[[2m6w]]' scene=''>
== Structural highlights ==
== Structural highlights ==
<table><tr><td colspan='2'>[[2m6w]] is a 1 chain structure. Full experimental information is available from [http://oca.weizmann.ac.il/oca-bin/ocashort?id=2M6W OCA]. For a <b>guided tour on the structure components</b> use [https://proteopedia.org/fgij/fg.htm?mol=2M6W FirstGlance]. <br>
<table><tr><td colspan='2'>[[2m6w]] is a 1 chain structure. Full experimental information is available from [http://oca.weizmann.ac.il/oca-bin/ocashort?id=2M6W OCA]. For a <b>guided tour on the structure components</b> use [https://proteopedia.org/fgij/fg.htm?mol=2M6W FirstGlance]. <br>
Line 20: Line 20:
</StructureSection>
</StructureSection>
[[Category: Large Structures]]
[[Category: Large Structures]]
-
[[Category: Karsisiotis, A I]]
+
[[Category: Karsisiotis AI]]
-
[[Category: Silva, M Webba da]]
+
[[Category: Webba da Silva M]]
-
[[Category: Dna]]
+
-
[[Category: Folding topology]]
+
-
[[Category: G-quadruplex]]
+

Revision as of 09:29, 14 June 2023

Solution NMR structure of the d(GGGGTTGGGGTTTTGGGGAAGGGG) quadruplex in sodium conditions

PDB ID 2m6w

Drag the structure with the mouse to rotate

Proteopedia Page Contributors and Editors (what is this?)

OCA

Personal tools