This old version of Proteopedia is provided for student assignments while the new version is undergoing repairs. Content and edits done in this old version of Proteopedia after March 1, 2026 will eventually be lost when it is retired in about June of 2026.


Apply for new accounts at the new Proteopedia. Your logins will work in both the old and new versions.


1qwa

From Proteopedia

(Difference between revisions)
Jump to: navigation, search
Current revision (06:34, 1 May 2024) (edit) (undo)
 
Line 4: Line 4:
== Structural highlights ==
== Structural highlights ==
<table><tr><td colspan='2'>[[1qwa]] is a 1 chain structure with sequence from [https://en.wikipedia.org/wiki/Mus_musculus Mus musculus]. Full experimental information is available from [http://oca.weizmann.ac.il/oca-bin/ocashort?id=1QWA OCA]. For a <b>guided tour on the structure components</b> use [https://proteopedia.org/fgij/fg.htm?mol=1QWA FirstGlance]. <br>
<table><tr><td colspan='2'>[[1qwa]] is a 1 chain structure with sequence from [https://en.wikipedia.org/wiki/Mus_musculus Mus musculus]. Full experimental information is available from [http://oca.weizmann.ac.il/oca-bin/ocashort?id=1QWA OCA]. For a <b>guided tour on the structure components</b> use [https://proteopedia.org/fgij/fg.htm?mol=1QWA FirstGlance]. <br>
-
</td></tr><tr id='resources'><td class="sblockLbl"><b>Resources:</b></td><td class="sblockDat"><span class='plainlinks'>[https://proteopedia.org/fgij/fg.htm?mol=1qwa FirstGlance], [http://oca.weizmann.ac.il/oca-bin/ocaids?id=1qwa OCA], [https://pdbe.org/1qwa PDBe], [https://www.rcsb.org/pdb/explore.do?structureId=1qwa RCSB], [https://www.ebi.ac.uk/pdbsum/1qwa PDBsum], [https://prosat.h-its.org/prosat/prosatexe?pdbcode=1qwa ProSAT]</span></td></tr>
+
</td></tr><tr id='method'><td class="sblockLbl"><b>[[Empirical_models|Method:]]</b></td><td class="sblockDat" id="methodDat">Solution NMR</td></tr>
 +
<tr id='resources'><td class="sblockLbl"><b>Resources:</b></td><td class="sblockDat"><span class='plainlinks'>[https://proteopedia.org/fgij/fg.htm?mol=1qwa FirstGlance], [http://oca.weizmann.ac.il/oca-bin/ocaids?id=1qwa OCA], [https://pdbe.org/1qwa PDBe], [https://www.rcsb.org/pdb/explore.do?structureId=1qwa RCSB], [https://www.ebi.ac.uk/pdbsum/1qwa PDBsum], [https://prosat.h-its.org/prosat/prosatexe?pdbcode=1qwa ProSAT]</span></td></tr>
</table>
</table>
-
<div style="background-color:#fffaf0;">
 
-
== Publication Abstract from PubMed ==
 
-
Nucleolin, a multi-domain protein involved in ribosome biogenesis, has been shown to bind the consensus sequence (U/G)CCCG(A/G) in the context of a hairpin loop structure (nucleolin recognition element; NRE). Previous studies have shown that the first two RNA-binding domains in nucleolin (RBD12) are responsible for the interaction with the in vitro selected NRE (sNRE). We have previously reported the structures of nucleolin RBD12, sNRE and nucleolin RBD12-sNRE complex. A comparison of free and bound sNRE shows that the NRE loop becomes structured upon binding. From this observation, we hypothesized that the disordered hairpin loop of sNRE facilitates conformational rearrangements when the protein binds. Here, we show that nucleolin RBD12 is also sufficient for sequence- specific binding of two NRE sequences found in pre-rRNA, b1NRE and b2NRE. Structural investigations of the free NREs using NMR spectroscopy show that the b1NRE loop is conformationally heterogeneous, while the b2NRE loop is structured. The b2NRE forms a hairpin capped by a YNMG-like tetraloop. Comparison of the chemical shifts of sNRE and b2NRE in complex with nucleolin RBD12 suggests that the NRE consensus nucleotides adopt a similar conformation. These results show that a disordered NRE consensus sequence is not a prerequisite for nucleolin RBD12 binding.
 
- 
-
Solution structures of stem-loop RNAs that bind to the two N-terminal RNA-binding domains of nucleolin.,Finger LD, Trantirek L, Johansson C, Feigon J Nucleic Acids Res. 2003 Nov 15;31(22):6461-72. PMID:14602904<ref>PMID:14602904</ref>
 
- 
-
From MEDLINE&reg;/PubMed&reg;, a database of the U.S. National Library of Medicine.<br>
 
-
</div>
 
-
<div class="pdbe-citations 1qwa" style="background-color:#fffaf0;"></div>
 
-
== References ==
 
-
<references/>
 
__TOC__
__TOC__
</StructureSection>
</StructureSection>

Current revision

NMR structure of 5'-r(GGAUGCCUCCCGAGUGCAUCC): an RNA hairpin derived from the mouse 5'ETS that binds nucleolin RBD12.

PDB ID 1qwa

Drag the structure with the mouse to rotate

Proteopedia Page Contributors and Editors (what is this?)

OCA

Personal tools