This old version of Proteopedia is provided for student assignments while the new version is undergoing repairs. Content and edits done in this old version of Proteopedia after March 1, 2026 will eventually be lost when it is retired in about June of 2026.

Apply for new accounts at the new Proteopedia. Your logins will work in both the old and new versions.


1ju0

From Proteopedia

(Difference between revisions)
Jump to: navigation, search
Line 1: Line 1:
-
[[Image:1ju0.gif|left|200px]]
+
{{Seed}}
 +
[[Image:1ju0.png|left|200px]]
<!--
<!--
Line 9: Line 10:
{{STRUCTURE_1ju0| PDB=1ju0 | SCENE= }}
{{STRUCTURE_1ju0| PDB=1ju0 | SCENE= }}
-
'''NMR solution structure of a DNA kissing complex'''
+
===NMR solution structure of a DNA kissing complex===
-
==Overview==
+
<!--
-
The deoxyoligoribonucleotide d(CTTGCTGAAGCGCGCACGGCAAG) (dSL1) corresponding to the reverse transcripted sequence of the dimerization initiation site SL1 of HIV- 1(Lai) RNA was synthesized using phosphoramidite chemistry. Like its oligoribonucleotide counterpart, dSL1 dimerized spontaneously in solution. Here we report the first NMR solution structure of a kissing complex formed with two DNA strands. The melting point of the DNA dimer (35 degrees C) was found slightly higher than the one of the corresponding RNA dimer (32 degrees C). Despite this only slight difference in melting point, several structural differences were observed between the ribo- and the deoxyribo- dimers. The solution structure of the deoxy- dimer was a symmetric homodimer with a loop-loop interaction stabilized by four central G-C base-pairs, a head to tail A-A base-pair arrangement between the A8 residues of the two strands and a stacking of A9 with C15. As a consequence, G10 was not paired and occupied a position outside the stem and the loop. Each stem was formed by seven base-pairs whose axis made an angle of about 100 degree with the plane of the loops. The distortion of the helix at the junction of the stem and of the loop induced a fold up of the A8pA9 step with a phosphate-phosphate distance lowered to 4.5 A. The plane of the non-canonical A-A base-pair was oriented perpendicularly to the axis of the stems. The four central base-pairs formed an open fan-shaped motif with an angle of 20 degrees between the bases and each of them was oriented perpendicularly to the A8-A8 plane. The deviation of the computed chemical shifts and the experimental ones for the aromatic proton was always less than 0.25ppm for each of the 16 converged solution structures and their average less than 0.1ppm.
+
The line below this paragraph, {{ABSTRACT_PUBMED_11843626}}, adds the Publication Abstract to the page
 +
(as it appears on PubMed at http://www.pubmed.gov), where 11843626 is the PubMed ID number.
 +
-->
 +
{{ABSTRACT_PUBMED_11843626}}
==About this Structure==
==About this Structure==
-
Full crystallographic information is available from [http://oca.weizmann.ac.il/oca-bin/ocashort?id=1JU0 OCA].
+
Full experimental information is available from [http://oca.weizmann.ac.il/oca-bin/ocashort?id=1JU0 OCA].
==Reference==
==Reference==
Line 29: Line 33:
[[Category: Loop-loop dimer]]
[[Category: Loop-loop dimer]]
[[Category: Sl1]]
[[Category: Sl1]]
-
''Page seeded by [http://oca.weizmann.ac.il/oca OCA ] on Fri May 2 21:55:08 2008''
+
 
 +
''Page seeded by [http://oca.weizmann.ac.il/oca OCA ] on Tue Jul 1 20:51:28 2008''

Revision as of 17:51, 1 July 2008

Image:1ju0.png

Template:STRUCTURE 1ju0

NMR solution structure of a DNA kissing complex

Template:ABSTRACT PUBMED 11843626

About this Structure

Full experimental information is available from OCA.

Reference

A new peculiar DNA structure: NMR solution structure of a DNA kissing complex., Barbault F, Huynh-Dinh T, Paoletti J, Lanceloti G, J Biomol Struct Dyn. 2002 Feb;19(4):649-58. PMID:11843626

Page seeded by OCA on Tue Jul 1 20:51:28 2008

Proteopedia Page Contributors and Editors (what is this?)

OCA

Retrieved from "http://52.214.119.220/wiki/index.php/1ju0"
Personal tools