9pz7

From Proteopedia

(Difference between revisions)
Jump to: navigation, search
m (Protected "9pz7" [edit=sysop:move=sysop])
Line 1: Line 1:
'''Unreleased structure'''
'''Unreleased structure'''
-
The entry 9pz7 is ON HOLD
+
The entry 9pz7 is ON HOLD until Paper Publication
Authors: Werther, R., Stoddard, B.L.
Authors: Werther, R., Stoddard, B.L.
-
Description: Engineered variant of I-OnuI meganuclease to target DNA sequence TTTCCACTTATTCACTATTTTA
+
Description: One of a series of engineered variants of I-OnuI meganuclease targeting altered DNA target sequence
[[Category: Unreleased Structures]]
[[Category: Unreleased Structures]]
-
[[Category: Stoddard, B.L]]
 
[[Category: Werther, R]]
[[Category: Werther, R]]
 +
[[Category: Stoddard, B.L]]

Revision as of 09:04, 3 September 2025

Unreleased structure

The entry 9pz7 is ON HOLD until Paper Publication

Authors: Werther, R., Stoddard, B.L.

Description: One of a series of engineered variants of I-OnuI meganuclease targeting altered DNA target sequence

Proteopedia Page Contributors and Editors (what is this?)

OCA

Personal tools