This old version of Proteopedia is provided for student assignments while the new version is undergoing repairs. Content and edits done in this old version of Proteopedia after March 1, 2026 will eventually be lost when it is retired in about June of 2026.


Apply for new accounts at the new Proteopedia. Your logins will work in both the old and new versions.


1qwb

From Proteopedia

(Difference between revisions)
Jump to: navigation, search
Line 1: Line 1:
-
{{Seed}}
 
[[Image:1qwb.png|left|200px]]
[[Image:1qwb.png|left|200px]]
-
<!--
 
-
The line below this paragraph, containing "STRUCTURE_1qwb", creates the "Structure Box" on the page.
 
-
You may change the PDB parameter (which sets the PDB file loaded into the applet)
 
-
or the SCENE parameter (which sets the initial scene displayed when the page is loaded),
 
-
or leave the SCENE parameter empty for the default display.
 
-
-->
 
{{STRUCTURE_1qwb| PDB=1qwb | SCENE= }}
{{STRUCTURE_1qwb| PDB=1qwb | SCENE= }}
===NMR strucutre of 5'-r(GGACACGAAAUCCCGAAGUAGUGUCC)-3' : an RNA hairpin containing the in vitro selected consensus sequence for nucleolin RBD12===
===NMR strucutre of 5'-r(GGACACGAAAUCCCGAAGUAGUGUCC)-3' : an RNA hairpin containing the in vitro selected consensus sequence for nucleolin RBD12===
- 
-
<!--
 
-
The line below this paragraph, {{ABSTRACT_PUBMED_14602904}}, adds the Publication Abstract to the page
 
-
(as it appears on PubMed at http://www.pubmed.gov), where 14602904 is the PubMed ID number.
 
-
-->
 
{{ABSTRACT_PUBMED_14602904}}
{{ABSTRACT_PUBMED_14602904}}
==About this Structure==
==About this Structure==
-
Full experimental information is available from [http://oca.weizmann.ac.il/oca-bin/ocashort?id=1QWB OCA].
+
[[1qwb]] is a 1 chain structure. Full experimental information is available from [http://oca.weizmann.ac.il/oca-bin/ocashort?id=1QWB OCA].
==Reference==
==Reference==
-
Solution structures of stem-loop RNAs that bind to the two N-terminal RNA-binding domains of nucleolin., Finger LD, Trantirek L, Johansson C, Feigon J, Nucleic Acids Res. 2003 Nov 15;31(22):6461-72. PMID:[http://www.ncbi.nlm.nih.gov/pubmed/14602904 14602904]
+
<ref group="xtra">PMID:014602904</ref><references group="xtra"/>
[[Category: Feigon, J.]]
[[Category: Feigon, J.]]
[[Category: Finger, L D.]]
[[Category: Finger, L D.]]
Line 31: Line 19:
[[Category: Disordered hairpin loop]]
[[Category: Disordered hairpin loop]]
[[Category: Loop e motif]]
[[Category: Loop e motif]]
 +
[[Category: Rna]]
[[Category: S-turn]]
[[Category: S-turn]]
- 
-
''Page seeded by [http://oca.weizmann.ac.il/oca OCA ] on Mon Jul 28 10:48:43 2008''
 

Revision as of 15:45, 14 August 2012

Template:STRUCTURE 1qwb

NMR strucutre of 5'-r(GGACACGAAAUCCCGAAGUAGUGUCC)-3' : an RNA hairpin containing the in vitro selected consensus sequence for nucleolin RBD12

Template:ABSTRACT PUBMED 14602904

About this Structure

1qwb is a 1 chain structure. Full experimental information is available from OCA.

Reference

  • Finger LD, Trantirek L, Johansson C, Feigon J. Solution structures of stem-loop RNAs that bind to the two N-terminal RNA-binding domains of nucleolin. Nucleic Acids Res. 2003 Nov 15;31(22):6461-72. PMID:14602904

Proteopedia Page Contributors and Editors (what is this?)

OCA

Personal tools