3iv5
From Proteopedia
(Difference between revisions)
(New page: '''Unreleased structure''' The entry 3iv5 is ON HOLD until sometime in the future Authors: Stella, Stefano, Cascio, Duilio, Johnson, Reid C. Description: Crystal structure of Fis bound...) |
|||
| Line 1: | Line 1: | ||
'''Unreleased structure''' | '''Unreleased structure''' | ||
| - | The entry 3iv5 is ON HOLD | + | The entry 3iv5 is ON HOLD |
| - | Authors: Stella, | + | Authors: Stella, S., Cascio, D., Johnson, R.C. |
Description: Crystal structure of Fis bound to 27bp consensus sequence DNA F1(AAATTTGTTTGAATTTTGAGCAAATTT) | Description: Crystal structure of Fis bound to 27bp consensus sequence DNA F1(AAATTTGTTTGAATTTTGAGCAAATTT) | ||
| - | ''Page seeded by [http://oca.weizmann.ac.il/oca OCA ] on Wed Sep | + | ''Page seeded by [http://oca.weizmann.ac.il/oca OCA ] on Wed Sep 30 08:59:19 2009'' |
Revision as of 06:59, 30 September 2009
Unreleased structure
The entry 3iv5 is ON HOLD
Authors: Stella, S., Cascio, D., Johnson, R.C.
Description: Crystal structure of Fis bound to 27bp consensus sequence DNA F1(AAATTTGTTTGAATTTTGAGCAAATTT)
Page seeded by OCA on Wed Sep 30 08:59:19 2009
