We apologize for Proteopedia being slow to respond. For the past two years, a new implementation of Proteopedia has been being built. Soon, it will replace this 18-year old system. All existing content will be moved to the new system at a date that will be announced here.

3iv5

From Proteopedia

(Difference between revisions)
Jump to: navigation, search
(New page: '''Unreleased structure''' The entry 3iv5 is ON HOLD until sometime in the future Authors: Stella, Stefano, Cascio, Duilio, Johnson, Reid C. Description: Crystal structure of Fis bound...)
Line 1: Line 1:
'''Unreleased structure'''
'''Unreleased structure'''
-
The entry 3iv5 is ON HOLD until sometime in the future
+
The entry 3iv5 is ON HOLD
-
Authors: Stella, Stefano, Cascio, Duilio, Johnson, Reid C.
+
Authors: Stella, S., Cascio, D., Johnson, R.C.
Description: Crystal structure of Fis bound to 27bp consensus sequence DNA F1(AAATTTGTTTGAATTTTGAGCAAATTT)
Description: Crystal structure of Fis bound to 27bp consensus sequence DNA F1(AAATTTGTTTGAATTTTGAGCAAATTT)
-
''Page seeded by [http://oca.weizmann.ac.il/oca OCA ] on Wed Sep 9 09:08:12 2009''
+
''Page seeded by [http://oca.weizmann.ac.il/oca OCA ] on Wed Sep 30 08:59:19 2009''

Revision as of 06:59, 30 September 2009

Unreleased structure

The entry 3iv5 is ON HOLD

Authors: Stella, S., Cascio, D., Johnson, R.C.

Description: Crystal structure of Fis bound to 27bp consensus sequence DNA F1(AAATTTGTTTGAATTTTGAGCAAATTT)

Page seeded by OCA on Wed Sep 30 08:59:19 2009

Proteopedia Page Contributors and Editors (what is this?)

OCA

Personal tools