We apologize for Proteopedia being slow to respond. For the past two years, a new implementation of Proteopedia has been being built. Soon, it will replace this 18-year old system. All existing content will be moved to the new system at a date that will be announced here.

3iv5

From Proteopedia

(Difference between revisions)
Jump to: navigation, search
Line 1: Line 1:
'''Unreleased structure'''
'''Unreleased structure'''
-
The entry 3iv5 is ON HOLD
+
The entry 3iv5 is ON HOLD until Paper Publication
Authors: Stella, S., Cascio, D., Johnson, R.C.
Authors: Stella, S., Cascio, D., Johnson, R.C.
-
Description: Crystal structure of Fis bound to 27bp consensus sequence DNA F1(AAATTTGTTTGAATTTTGAGCAAATTT)
+
Description: Crystal structure of Fis bound to 27 bp optimal binding sequence F1
-
''Page seeded by [http://oca.weizmann.ac.il/oca OCA ] on Wed Sep 30 08:59:19 2009''
+
''Page seeded by [http://oca.weizmann.ac.il/oca OCA ] on Wed Dec 23 09:19:18 2009''

Revision as of 07:19, 23 December 2009

Unreleased structure

The entry 3iv5 is ON HOLD until Paper Publication

Authors: Stella, S., Cascio, D., Johnson, R.C.

Description: Crystal structure of Fis bound to 27 bp optimal binding sequence F1

Page seeded by OCA on Wed Dec 23 09:19:18 2009

Proteopedia Page Contributors and Editors (what is this?)

OCA

Personal tools