1qwa
From Proteopedia
(Difference between revisions)
| Line 1: | Line 1: | ||
| - | {{Seed}} | ||
[[Image:1qwa.png|left|200px]] | [[Image:1qwa.png|left|200px]] | ||
| Line 20: | Line 19: | ||
==About this Structure== | ==About this Structure== | ||
| - | + | [[1qwa]] is a 1 chain structure. Full experimental information is available from [http://oca.weizmann.ac.il/oca-bin/ocashort?id=1QWA OCA]. | |
==Reference== | ==Reference== | ||
| - | + | <ref group="xtra">PMID:014602904</ref><references group="xtra"/> | |
| - | + | ||
[[Category: Feigon, J.]] | [[Category: Feigon, J.]] | ||
[[Category: Finger, L D.]] | [[Category: Finger, L D.]] | ||
| Line 32: | Line 30: | ||
[[Category: Bulged nucleotide]] | [[Category: Bulged nucleotide]] | ||
[[Category: Hairpin]] | [[Category: Hairpin]] | ||
| + | [[Category: Rna]] | ||
[[Category: Tetraloop]] | [[Category: Tetraloop]] | ||
[[Category: Uncg]] | [[Category: Uncg]] | ||
[[Category: Uucg]] | [[Category: Uucg]] | ||
[[Category: Ynmg]] | [[Category: Ynmg]] | ||
| - | |||
| - | ''Page seeded by [http://oca.weizmann.ac.il/oca OCA ] on Tue Jul 29 08:13:30 2008'' | ||
Revision as of 06:35, 1 February 2012
NMR structure of 5'-r(GGAUGCCUCCCGAGUGCAUCC): an RNA hairpin derived from the mouse 5'ETS that binds nucleolin RBD12.
Template:ABSTRACT PUBMED 14602904
About this Structure
1qwa is a 1 chain structure. Full experimental information is available from OCA.
Reference
- Finger LD, Trantirek L, Johansson C, Feigon J. Solution structures of stem-loop RNAs that bind to the two N-terminal RNA-binding domains of nucleolin. Nucleic Acids Res. 2003 Nov 15;31(22):6461-72. PMID:14602904
Categories: Feigon, J. | Finger, L D. | Johansson, C. | Trantirek, L. | A-form helix | Bulged nucleotide | Hairpin | Rna | Tetraloop | Uncg | Uucg | Ynmg
