1qwb
From Proteopedia
(Difference between revisions)
| Line 1: | Line 1: | ||
| - | {{Seed}} | ||
[[Image:1qwb.png|left|200px]] | [[Image:1qwb.png|left|200px]] | ||
| - | <!-- | ||
| - | The line below this paragraph, containing "STRUCTURE_1qwb", creates the "Structure Box" on the page. | ||
| - | You may change the PDB parameter (which sets the PDB file loaded into the applet) | ||
| - | or the SCENE parameter (which sets the initial scene displayed when the page is loaded), | ||
| - | or leave the SCENE parameter empty for the default display. | ||
| - | --> | ||
{{STRUCTURE_1qwb| PDB=1qwb | SCENE= }} | {{STRUCTURE_1qwb| PDB=1qwb | SCENE= }} | ||
===NMR strucutre of 5'-r(GGACACGAAAUCCCGAAGUAGUGUCC)-3' : an RNA hairpin containing the in vitro selected consensus sequence for nucleolin RBD12=== | ===NMR strucutre of 5'-r(GGACACGAAAUCCCGAAGUAGUGUCC)-3' : an RNA hairpin containing the in vitro selected consensus sequence for nucleolin RBD12=== | ||
| - | |||
| - | <!-- | ||
| - | The line below this paragraph, {{ABSTRACT_PUBMED_14602904}}, adds the Publication Abstract to the page | ||
| - | (as it appears on PubMed at http://www.pubmed.gov), where 14602904 is the PubMed ID number. | ||
| - | --> | ||
{{ABSTRACT_PUBMED_14602904}} | {{ABSTRACT_PUBMED_14602904}} | ||
==About this Structure== | ==About this Structure== | ||
| - | Full experimental information is available from [http://oca.weizmann.ac.il/oca-bin/ocashort?id=1QWB OCA]. | + | [[1qwb]] is a 1 chain structure. Full experimental information is available from [http://oca.weizmann.ac.il/oca-bin/ocashort?id=1QWB OCA]. |
==Reference== | ==Reference== | ||
| - | + | <ref group="xtra">PMID:014602904</ref><references group="xtra"/> | |
[[Category: Feigon, J.]] | [[Category: Feigon, J.]] | ||
[[Category: Finger, L D.]] | [[Category: Finger, L D.]] | ||
| Line 31: | Line 19: | ||
[[Category: Disordered hairpin loop]] | [[Category: Disordered hairpin loop]] | ||
[[Category: Loop e motif]] | [[Category: Loop e motif]] | ||
| + | [[Category: Rna]] | ||
[[Category: S-turn]] | [[Category: S-turn]] | ||
| - | |||
| - | ''Page seeded by [http://oca.weizmann.ac.il/oca OCA ] on Mon Jul 28 10:48:43 2008'' | ||
Revision as of 15:45, 14 August 2012
NMR strucutre of 5'-r(GGACACGAAAUCCCGAAGUAGUGUCC)-3' : an RNA hairpin containing the in vitro selected consensus sequence for nucleolin RBD12
Template:ABSTRACT PUBMED 14602904
About this Structure
1qwb is a 1 chain structure. Full experimental information is available from OCA.
Reference
- Finger LD, Trantirek L, Johansson C, Feigon J. Solution structures of stem-loop RNAs that bind to the two N-terminal RNA-binding domains of nucleolin. Nucleic Acids Res. 2003 Nov 15;31(22):6461-72. PMID:14602904
