We apologize for Proteopedia being slow to respond. For the past two years, a new implementation of Proteopedia has been being built. Soon, it will replace this 18-year old system. All existing content will be moved to the new system at a date that will be announced here.
4ihv
From Proteopedia
(Difference between revisions)
OCA (Talk | contribs)
(New page: '''Unreleased structure''' The entry 4ihv is ON HOLD Authors: Hancock, Stephen P., Cascio, Duilio, Johnson, Reid C. Description: Crystal structure of Fis bound to 27 bp sequence DNA F2...)
Next diff →
Revision as of 08:59, 2 January 2013
Unreleased structure
The entry 4ihv is ON HOLD
Authors: Hancock, Stephen P., Cascio, Duilio, Johnson, Reid C.
Description: Crystal structure of Fis bound to 27 bp sequence DNA F28 (AAATTTGTTTGAGCGTTGAGCAAATTT)
