We apologize for Proteopedia being slow to respond. For the past two years, a new implementation of Proteopedia has been being built. Soon, it will replace this 18-year old system. All existing content will be moved to the new system at a date that will be announced here.

4ihv

From Proteopedia

(Difference between revisions)
Jump to: navigation, search
(New page: '''Unreleased structure''' The entry 4ihv is ON HOLD Authors: Hancock, Stephen P., Cascio, Duilio, Johnson, Reid C. Description: Crystal structure of Fis bound to 27 bp sequence DNA F2...)
m (Protected "4ihv" [edit=sysop:move=sysop])

Revision as of 08:59, 2 January 2013

Unreleased structure

The entry 4ihv is ON HOLD

Authors: Hancock, Stephen P., Cascio, Duilio, Johnson, Reid C.

Description: Crystal structure of Fis bound to 27 bp sequence DNA F28 (AAATTTGTTTGAGCGTTGAGCAAATTT)

Proteopedia Page Contributors and Editors (what is this?)

OCA

Personal tools