We apologize for Proteopedia being slow to respond. For the past two years, a new implementation of Proteopedia has been being built. Soon, it will replace this 18-year old system. All existing content will be moved to the new system at a date that will be announced here.
4ihv
From Proteopedia
(Difference between revisions)
| Line 1: | Line 1: | ||
| - | + | {{STRUCTURE_4ihv| PDB=4ihv | SCENE= }} | |
| + | ===Crystal structure of Fis bound to 27 bp sequence DNA F28 (AAATTTGTTTGAGCGTTGAGCAAATTT)=== | ||
| - | + | ==Function== | |
| + | [[http://www.uniprot.org/uniprot/C9QXL3_ECOD1 C9QXL3_ECOD1]] Activates ribosomal RNA transcription. Plays a direct role in upstream activation of rRNA promoters (By similarity).[HAMAP-Rule:MF_00166] | ||
| - | + | ==About this Structure== | |
| - | + | [[4ihv]] is a 4 chain structure with sequence from [http://en.wikipedia.org/wiki/Escherichia_coli_k-12 Escherichia coli k-12]. Full crystallographic information is available from [http://oca.weizmann.ac.il/oca-bin/ocashort?id=4IHV OCA]. | |
| - | + | [[Category: Escherichia coli k-12]] | |
| + | [[Category: Cascio, D.]] | ||
| + | [[Category: Hancock, S P.]] | ||
| + | [[Category: Johnson, R C.]] | ||
| + | [[Category: Dna bending]] | ||
| + | [[Category: Hth domain]] | ||
| + | [[Category: Indirect recognition]] | ||
| + | [[Category: Minor groove compression]] | ||
| + | [[Category: Protein-dna complex]] | ||
| + | [[Category: Transcription-dna complex]] | ||
Revision as of 07:52, 2 May 2013
Crystal structure of Fis bound to 27 bp sequence DNA F28 (AAATTTGTTTGAGCGTTGAGCAAATTT)
Function
[C9QXL3_ECOD1] Activates ribosomal RNA transcription. Plays a direct role in upstream activation of rRNA promoters (By similarity).[HAMAP-Rule:MF_00166]
About this Structure
4ihv is a 4 chain structure with sequence from Escherichia coli k-12. Full crystallographic information is available from OCA.
