4ihv

From Proteopedia

(Difference between revisions)
Jump to: navigation, search
Line 1: Line 1:
-
'''Unreleased structure'''
+
{{STRUCTURE_4ihv| PDB=4ihv | SCENE= }}
 +
===Crystal structure of Fis bound to 27 bp sequence DNA F28 (AAATTTGTTTGAGCGTTGAGCAAATTT)===
-
The entry 4ihv is ON HOLD
+
==Function==
 +
[[http://www.uniprot.org/uniprot/C9QXL3_ECOD1 C9QXL3_ECOD1]] Activates ribosomal RNA transcription. Plays a direct role in upstream activation of rRNA promoters (By similarity).[HAMAP-Rule:MF_00166]
-
Authors: Hancock, S.P., Cascio, D., Johnson, R.C.
+
==About this Structure==
-
 
+
[[4ihv]] is a 4 chain structure with sequence from [http://en.wikipedia.org/wiki/Escherichia_coli_k-12 Escherichia coli k-12]. Full crystallographic information is available from [http://oca.weizmann.ac.il/oca-bin/ocashort?id=4IHV OCA].
-
Description: Crystal structure of Fis bound to 27 bp sequence DNA F28 (AAATTTGTTTGAGCGTTGAGCAAATTT)
+
[[Category: Escherichia coli k-12]]
 +
[[Category: Cascio, D.]]
 +
[[Category: Hancock, S P.]]
 +
[[Category: Johnson, R C.]]
 +
[[Category: Dna bending]]
 +
[[Category: Hth domain]]
 +
[[Category: Indirect recognition]]
 +
[[Category: Minor groove compression]]
 +
[[Category: Protein-dna complex]]
 +
[[Category: Transcription-dna complex]]

Revision as of 07:52, 2 May 2013

Template:STRUCTURE 4ihv

Crystal structure of Fis bound to 27 bp sequence DNA F28 (AAATTTGTTTGAGCGTTGAGCAAATTT)

Function

[C9QXL3_ECOD1] Activates ribosomal RNA transcription. Plays a direct role in upstream activation of rRNA promoters (By similarity).[HAMAP-Rule:MF_00166]

About this Structure

4ihv is a 4 chain structure with sequence from Escherichia coli k-12. Full crystallographic information is available from OCA.

Proteopedia Page Contributors and Editors (what is this?)

OCA

Retrieved from "http://52.214.119.220/wiki/index.php/4ihv"
Personal tools