This old version of Proteopedia is provided for student assignments while the new version is undergoing repairs. Content and edits done in this old version of Proteopedia after March 1, 2026 will eventually be lost when it is retired in about June of 2026.


Apply for new accounts at the new Proteopedia. Your logins will work in both the old and new versions.


4ihv

From Proteopedia

(Difference between revisions)
Jump to: navigation, search
Line 1: Line 1:
-
'''Unreleased structure'''
+
{{STRUCTURE_4ihv| PDB=4ihv | SCENE= }}
 +
===Crystal structure of Fis bound to 27 bp sequence DNA F28 (AAATTTGTTTGAGCGTTGAGCAAATTT)===
-
The entry 4ihv is ON HOLD
+
==Function==
 +
[[http://www.uniprot.org/uniprot/C9QXL3_ECOD1 C9QXL3_ECOD1]] Activates ribosomal RNA transcription. Plays a direct role in upstream activation of rRNA promoters (By similarity).[HAMAP-Rule:MF_00166]
-
Authors: Hancock, S.P., Cascio, D., Johnson, R.C.
+
==About this Structure==
-
 
+
[[4ihv]] is a 4 chain structure with sequence from [http://en.wikipedia.org/wiki/Escherichia_coli_k-12 Escherichia coli k-12]. Full crystallographic information is available from [http://oca.weizmann.ac.il/oca-bin/ocashort?id=4IHV OCA].
-
Description: Crystal structure of Fis bound to 27 bp sequence DNA F28 (AAATTTGTTTGAGCGTTGAGCAAATTT)
+
[[Category: Escherichia coli k-12]]
 +
[[Category: Cascio, D.]]
 +
[[Category: Hancock, S P.]]
 +
[[Category: Johnson, R C.]]
 +
[[Category: Dna bending]]
 +
[[Category: Hth domain]]
 +
[[Category: Indirect recognition]]
 +
[[Category: Minor groove compression]]
 +
[[Category: Protein-dna complex]]
 +
[[Category: Transcription-dna complex]]

Revision as of 07:52, 2 May 2013

Template:STRUCTURE 4ihv

Crystal structure of Fis bound to 27 bp sequence DNA F28 (AAATTTGTTTGAGCGTTGAGCAAATTT)

Function

[C9QXL3_ECOD1] Activates ribosomal RNA transcription. Plays a direct role in upstream activation of rRNA promoters (By similarity).[HAMAP-Rule:MF_00166]

About this Structure

4ihv is a 4 chain structure with sequence from Escherichia coli k-12. Full crystallographic information is available from OCA.

Proteopedia Page Contributors and Editors (what is this?)

OCA

Personal tools