This old version of Proteopedia is provided for student assignments while the new version is undergoing repairs. Content and edits done in this old version of Proteopedia after March 1, 2026 will eventually be lost when it is retired in about June of 2026.
Apply for new accounts at the new Proteopedia. Your logins will work in both the old and new versions.
4ihv
From Proteopedia
(Difference between revisions)
| Line 1: | Line 1: | ||
| - | + | {{STRUCTURE_4ihv| PDB=4ihv | SCENE= }} | |
| + | ===Crystal structure of Fis bound to 27 bp sequence DNA F28 (AAATTTGTTTGAGCGTTGAGCAAATTT)=== | ||
| - | + | ==Function== | |
| + | [[http://www.uniprot.org/uniprot/C9QXL3_ECOD1 C9QXL3_ECOD1]] Activates ribosomal RNA transcription. Plays a direct role in upstream activation of rRNA promoters (By similarity).[HAMAP-Rule:MF_00166] | ||
| - | + | ==About this Structure== | |
| - | + | [[4ihv]] is a 4 chain structure with sequence from [http://en.wikipedia.org/wiki/Escherichia_coli_k-12 Escherichia coli k-12]. Full crystallographic information is available from [http://oca.weizmann.ac.il/oca-bin/ocashort?id=4IHV OCA]. | |
| - | + | [[Category: Escherichia coli k-12]] | |
| + | [[Category: Cascio, D.]] | ||
| + | [[Category: Hancock, S P.]] | ||
| + | [[Category: Johnson, R C.]] | ||
| + | [[Category: Dna bending]] | ||
| + | [[Category: Hth domain]] | ||
| + | [[Category: Indirect recognition]] | ||
| + | [[Category: Minor groove compression]] | ||
| + | [[Category: Protein-dna complex]] | ||
| + | [[Category: Transcription-dna complex]] | ||
Revision as of 07:52, 2 May 2013
Crystal structure of Fis bound to 27 bp sequence DNA F28 (AAATTTGTTTGAGCGTTGAGCAAATTT)
Function
[C9QXL3_ECOD1] Activates ribosomal RNA transcription. Plays a direct role in upstream activation of rRNA promoters (By similarity).[HAMAP-Rule:MF_00166]
About this Structure
4ihv is a 4 chain structure with sequence from Escherichia coli k-12. Full crystallographic information is available from OCA.
