We apologize for Proteopedia being slow to respond. For the past two years, a new implementation of Proteopedia has been being built. Soon, it will replace this 18-year old system. All existing content will be moved to the new system at a date that will be announced here.
4ihv
From Proteopedia
(Difference between revisions)
| Line 1: | Line 1: | ||
{{STRUCTURE_4ihv| PDB=4ihv | SCENE= }} | {{STRUCTURE_4ihv| PDB=4ihv | SCENE= }} | ||
===Crystal structure of Fis bound to 27 bp sequence DNA F28 (AAATTTGTTTGAGCGTTGAGCAAATTT)=== | ===Crystal structure of Fis bound to 27 bp sequence DNA F28 (AAATTTGTTTGAGCGTTGAGCAAATTT)=== | ||
| + | {{ABSTRACT_PUBMED_23661683}} | ||
==Function== | ==Function== | ||
| Line 7: | Line 8: | ||
==About this Structure== | ==About this Structure== | ||
[[4ihv]] is a 4 chain structure with sequence from [http://en.wikipedia.org/wiki/Escherichia_coli_k-12 Escherichia coli k-12]. Full crystallographic information is available from [http://oca.weizmann.ac.il/oca-bin/ocashort?id=4IHV OCA]. | [[4ihv]] is a 4 chain structure with sequence from [http://en.wikipedia.org/wiki/Escherichia_coli_k-12 Escherichia coli k-12]. Full crystallographic information is available from [http://oca.weizmann.ac.il/oca-bin/ocashort?id=4IHV OCA]. | ||
| + | |||
| + | ==Reference== | ||
| + | <ref group="xtra">PMID:023661683</ref><references group="xtra"/><references/> | ||
[[Category: Escherichia coli k-12]] | [[Category: Escherichia coli k-12]] | ||
[[Category: Cascio, D.]] | [[Category: Cascio, D.]] | ||
Revision as of 15:55, 19 June 2013
Contents |
Crystal structure of Fis bound to 27 bp sequence DNA F28 (AAATTTGTTTGAGCGTTGAGCAAATTT)
Template:ABSTRACT PUBMED 23661683
Function
[C9QXL3_ECOD1] Activates ribosomal RNA transcription. Plays a direct role in upstream activation of rRNA promoters (By similarity).[HAMAP-Rule:MF_00166]
About this Structure
4ihv is a 4 chain structure with sequence from Escherichia coli k-12. Full crystallographic information is available from OCA.
Reference
- Hancock SP, Ghane T, Cascio D, Rohs R, Di Felice R, Johnson RC. Control of DNA minor groove width and Fis protein binding by the purine 2-amino group. Nucleic Acids Res. 2013 May 9. PMID:23661683 doi:10.1093/nar/gkt357
