This old version of Proteopedia is provided for student assignments while the new version is undergoing repairs. Content and edits done in this old version of Proteopedia after March 1, 2026 will eventually be lost when it is retired in about June of 2026.


Apply for new accounts at the new Proteopedia. Your logins will work in both the old and new versions.


4ihv

From Proteopedia

(Difference between revisions)
Jump to: navigation, search
Line 1: Line 1:
{{STRUCTURE_4ihv| PDB=4ihv | SCENE= }}
{{STRUCTURE_4ihv| PDB=4ihv | SCENE= }}
===Crystal structure of Fis bound to 27 bp sequence DNA F28 (AAATTTGTTTGAGCGTTGAGCAAATTT)===
===Crystal structure of Fis bound to 27 bp sequence DNA F28 (AAATTTGTTTGAGCGTTGAGCAAATTT)===
 +
{{ABSTRACT_PUBMED_23661683}}
==Function==
==Function==
Line 7: Line 8:
==About this Structure==
==About this Structure==
[[4ihv]] is a 4 chain structure with sequence from [http://en.wikipedia.org/wiki/Escherichia_coli_k-12 Escherichia coli k-12]. Full crystallographic information is available from [http://oca.weizmann.ac.il/oca-bin/ocashort?id=4IHV OCA].
[[4ihv]] is a 4 chain structure with sequence from [http://en.wikipedia.org/wiki/Escherichia_coli_k-12 Escherichia coli k-12]. Full crystallographic information is available from [http://oca.weizmann.ac.il/oca-bin/ocashort?id=4IHV OCA].
 +
 +
==Reference==
 +
<ref group="xtra">PMID:023661683</ref><references group="xtra"/><references/>
[[Category: Escherichia coli k-12]]
[[Category: Escherichia coli k-12]]
[[Category: Cascio, D.]]
[[Category: Cascio, D.]]

Revision as of 15:55, 19 June 2013

Template:STRUCTURE 4ihv

Contents

Crystal structure of Fis bound to 27 bp sequence DNA F28 (AAATTTGTTTGAGCGTTGAGCAAATTT)

Template:ABSTRACT PUBMED 23661683

Function

[C9QXL3_ECOD1] Activates ribosomal RNA transcription. Plays a direct role in upstream activation of rRNA promoters (By similarity).[HAMAP-Rule:MF_00166]

About this Structure

4ihv is a 4 chain structure with sequence from Escherichia coli k-12. Full crystallographic information is available from OCA.

Reference

  • Hancock SP, Ghane T, Cascio D, Rohs R, Di Felice R, Johnson RC. Control of DNA minor groove width and Fis protein binding by the purine 2-amino group. Nucleic Acids Res. 2013 May 9. PMID:23661683 doi:10.1093/nar/gkt357

Proteopedia Page Contributors and Editors (what is this?)

OCA

Personal tools