This old version of Proteopedia is provided for student assignments while the new version is undergoing repairs. Content and edits done in this old version of Proteopedia after March 1, 2026 will eventually be lost when it is retired in about June of 2026.
Apply for new accounts at the new Proteopedia. Your logins will work in both the old and new versions.
2m90
From Proteopedia
(Difference between revisions)
| Line 1: | Line 1: | ||
| - | + | {{STRUCTURE_2m90| PDB=2m90 | SCENE= }} | |
| + | ===Structure of d[GCGCGAAGCATTCGCGGGGAGGTGGGGAAGGG] quadruplex-duplex hybrid=== | ||
| + | {{ABSTRACT_PUBMED_23794476}} | ||
| - | + | ==About this Structure== | |
| + | [[2m90]] is a 1 chain structure. Full experimental information is available from [http://oca.weizmann.ac.il/oca-bin/ocashort?id=2M90 OCA]. | ||
| - | + | ==Reference== | |
| - | + | <ref group="xtra">PMID:023794476</ref><references group="xtra"/><references/> | |
| - | + | [[Category: Lim, K W.]] | |
| + | [[Category: Phan, A T.]] | ||
| + | [[Category: Dna]] | ||
| + | [[Category: Duplex]] | ||
| + | [[Category: Quadruplex]] | ||
| + | [[Category: Quadruplex-duplex hybrid]] | ||
Revision as of 15:41, 10 July 2013
Structure of d[GCGCGAAGCATTCGCGGGGAGGTGGGGAAGGG] quadruplex-duplex hybrid
Template:ABSTRACT PUBMED 23794476
About this Structure
2m90 is a 1 chain structure. Full experimental information is available from OCA.
Reference
- Lim KW, Phan AT. Structural Basis of DNA Quadruplex-Duplex Junction Formation. Angew Chem Int Ed Engl. 2013 Jun 21. doi: 10.1002/anie.201302995. PMID:23794476 doi:10.1002/anie.201302995
