2m93

From Proteopedia

proteopedia linkproteopedia link

Revision as of 12:44, 3 July 2013 (edit) OCA (Talk | contribs) ← Previous diff		Revision as of 15:44, 10 July 2013 (edit) (undo) OCA (Talk | contribs) Next diff →
Line 1:		Line 1:
-	'''Unreleased structure'''	+	{{STRUCTURE_2m93| PDB=2m93 | SCENE= }}
		+	===Structure of d[TTGGGTGGGCGCGAAGCATTCGCGGGGTGGGT] quadruplex-duplex hybrid===
		+	{{ABSTRACT_PUBMED_23794476}}
-	The entry 2m93 is ON HOLD until Paper Publication	+	==About this Structure==
		+	[[2m93]] is a 1 chain structure. Full experimental information is available from [http://oca.weizmann.ac.il/oca-bin/ocashort?id=2M93 OCA].
-	Authors: Lim, K.W., Phan, A.T.	+	==Reference==
-		+	<ref group="xtra">PMID:023794476</ref><references group="xtra"/><references/>
-	Description: Structure of d[TTGGGTGGGCGCGAAGCATTCGCGGGGTGGGT] quadruplex-duplex hybrid	+	[[Category: Lim, K W.]]
		+	[[Category: Phan, A T.]]
		+	[[Category: Dna]]
		+	[[Category: Duplex]]
		+	[[Category: Quadruplex]]
		+	[[Category: Quadruplex-duplex hybrid]]

---

Revision as of 15:44, 10 July 2013

Template:STRUCTURE 2m93

Structure of d[TTGGGTGGGCGCGAAGCATTCGCGGGGTGGGT] quadruplex-duplex hybrid

Template:ABSTRACT PUBMED 23794476

About this Structure

2m93 is a 1 chain structure. Full experimental information is available from OCA.

Reference

• Lim KW, Phan AT. Structural Basis of DNA Quadruplex-Duplex Junction Formation. Angew Chem Int Ed Engl. 2013 Jun 21. doi: 10.1002/anie.201302995. PMID:23794476 doi:10.1002/anie.201302995