2mo6
From Proteopedia
(Difference between revisions)
OCA (Talk | contribs)
(New page: '''Unreleased structure''' The entry 2mo6 is ON HOLD until sometime in the future Authors: Webba da Silva, M., Dvorkin, S.A., Karsisiotis, A.I. Description: G-quadruplex solution struc...)
Next diff →
Revision as of 05:37, 30 April 2014
Unreleased structure
The entry 2mo6 is ON HOLD until sometime in the future
Authors: Webba da Silva, M., Dvorkin, S.A., Karsisiotis, A.I.
Description: G-quadruplex solution structure formed by the sequence d(GGGTTTTGGGTTTTGGGAGGG) in sodium solution
