We apologize for Proteopedia being slow to respond. For the past two years, a new implementation of Proteopedia has been being built. Soon, it will replace this 18-year old system. All existing content will be moved to the new system at a date that will be announced here.

2mo6

From Proteopedia

(Difference between revisions)
Jump to: navigation, search

OCA (Talk | contribs)
(New page: '''Unreleased structure''' The entry 2mo6 is ON HOLD until sometime in the future Authors: Webba da Silva, M., Dvorkin, S.A., Karsisiotis, A.I. Description: G-quadruplex solution struc...)
Next diff →

Revision as of 05:37, 30 April 2014

Unreleased structure

The entry 2mo6 is ON HOLD until sometime in the future

Authors: Webba da Silva, M., Dvorkin, S.A., Karsisiotis, A.I.

Description: G-quadruplex solution structure formed by the sequence d(GGGTTTTGGGTTTTGGGAGGG) in sodium solution

Proteopedia Page Contributors and Editors (what is this?)

OCA

Personal tools