We apologize for Proteopedia being slow to respond. For the past two years, a new implementation of Proteopedia has been being built. Soon, it will replace this 18-year old system. All existing content will be moved to the new system at a date that will be announced here.
2mo6
From Proteopedia
(Difference between revisions)
(New page: '''Unreleased structure''' The entry 2mo6 is ON HOLD until sometime in the future Authors: Webba da Silva, M., Dvorkin, S.A., Karsisiotis, A.I. Description: G-quadruplex solution struc...) |
m (Protected "2mo6" [edit=sysop:move=sysop]) |
Revision as of 05:37, 30 April 2014
Unreleased structure
The entry 2mo6 is ON HOLD until sometime in the future
Authors: Webba da Silva, M., Dvorkin, S.A., Karsisiotis, A.I.
Description: G-quadruplex solution structure formed by the sequence d(GGGTTTTGGGTTTTGGGAGGG) in sodium solution
