We apologize for Proteopedia being slow to respond. For the past two years, a new implementation of Proteopedia has been being built. Soon, it will replace this 18-year old system. All existing content will be moved to the new system at a date that will be announced here.
2m6w
From Proteopedia
(Difference between revisions)
| Line 1: | Line 1: | ||
| - | ''' | + | ==Solution NMR structure of the d(GGGGTTGGGGTTTTGGGGAAGGGG) quadruplex in sodium conditions== |
| - | + | <StructureSection load='2m6w' size='340' side='right' caption='[[2m6w]], [[NMR_Ensembles_of_Models | 8 NMR models]]' scene=''> | |
| - | + | == Structural highlights == | |
| - | + | <table><tr><td colspan='2'>[[2m6w]] is a 1 chain structure. Full experimental information is available from [http://oca.weizmann.ac.il/oca-bin/ocashort?id=2M6W OCA]. For a <b>guided tour on the structure components</b> use [http://oca.weizmann.ac.il/oca-docs/fgij/fg.htm?mol=2M6W FirstGlance]. <br> | |
| - | + | </td></tr><tr><td class="sblockLbl"><b>Resources:</b></td><td class="sblockDat"><span class='plainlinks'>[http://oca.weizmann.ac.il/oca-docs/fgij/fg.htm?mol=2m6w FirstGlance], [http://oca.weizmann.ac.il/oca-bin/ocaids?id=2m6w OCA], [http://www.rcsb.org/pdb/explore.do?structureId=2m6w RCSB], [http://www.ebi.ac.uk/pdbsum/2m6w PDBsum]</span></td></tr> | |
| - | + | <table> | |
| - | + | __TOC__ | |
| + | </StructureSection> | ||
| + | [[Category: Karsisiotis, A.]] | ||
| + | [[Category: Silva, M Webba da.]] | ||
| + | [[Category: Dna]] | ||
| + | [[Category: Folding topology]] | ||
| + | [[Category: G-quadruplex]] | ||
Revision as of 08:02, 23 July 2014
Solution NMR structure of the d(GGGGTTGGGGTTTTGGGGAAGGGG) quadruplex in sodium conditions
| |||||||||||
