This old version of Proteopedia is provided for student assignments while the new version is undergoing repairs. Content and edits done in this old version of Proteopedia after March 1, 2026 will eventually be lost when it is retired in about June of 2026.


Apply for new accounts at the new Proteopedia. Your logins will work in both the old and new versions.


2m90

From Proteopedia

(Difference between revisions)
Jump to: navigation, search
Line 1: Line 1:
-
{{STRUCTURE_2m90| PDB=2m90 | SCENE= }}
+
==Structure of d[GCGCGAAGCATTCGCGGGGAGGTGGGGAAGGG] quadruplex-duplex hybrid==
-
===Structure of d[GCGCGAAGCATTCGCGGGGAGGTGGGGAAGGG] quadruplex-duplex hybrid===
+
<StructureSection load='2m90' size='340' side='right' caption='[[2m90]], [[NMR_Ensembles_of_Models | 10 NMR models]]' scene=''>
-
{{ABSTRACT_PUBMED_23794476}}
+
== Structural highlights ==
 +
<table><tr><td colspan='2'>[[2m90]] is a 1 chain structure. Full experimental information is available from [http://oca.weizmann.ac.il/oca-bin/ocashort?id=2M90 OCA]. For a <b>guided tour on the structure components</b> use [http://oca.weizmann.ac.il/oca-docs/fgij/fg.htm?mol=2M90 FirstGlance]. <br>
 +
</td></tr><tr id='related'><td class="sblockLbl"><b>[[Related_structure|Related:]]</b></td><td class="sblockDat">[[2m8y|2m8y]], [[2m8z|2m8z]], [[2m91|2m91]], [[2m92|2m92]], [[2m93|2m93]]</td></tr>
 +
<tr id='resources'><td class="sblockLbl"><b>Resources:</b></td><td class="sblockDat"><span class='plainlinks'>[http://oca.weizmann.ac.il/oca-docs/fgij/fg.htm?mol=2m90 FirstGlance], [http://oca.weizmann.ac.il/oca-bin/ocaids?id=2m90 OCA], [http://www.rcsb.org/pdb/explore.do?structureId=2m90 RCSB], [http://www.ebi.ac.uk/pdbsum/2m90 PDBsum]</span></td></tr>
 +
</table>
 +
<div style="background-color:#fffaf0;">
 +
== Publication Abstract from PubMed ==
 +
Coaxial and orthogonal orientations of the helices (left and right illustration, respectively) in a quadruplex-duplex junction were realized by incorporating a duplex hairpin across the diverse geometries of a quadruplex. The modularity of the approach was validated through the simultaneous attachment of multiple duplex stems onto a G-quadruplex scaffold to generate a G-junction.
-
==About this Structure==
+
Structural Basis of DNA Quadruplex-Duplex Junction Formation.,Lim KW, Phan AT Angew Chem Int Ed Engl. 2013 Jun 21. doi: 10.1002/anie.201302995. PMID:23794476<ref>PMID:23794476</ref>
-
[[2m90]] is a 1 chain structure. Full experimental information is available from [http://oca.weizmann.ac.il/oca-bin/ocashort?id=2M90 OCA].
+
-
==Reference==
+
From MEDLINE&reg;/PubMed&reg;, a database of the U.S. National Library of Medicine.<br>
-
<ref group="xtra">PMID:023794476</ref><references group="xtra"/><references/>
+
</div>
-
[[Category: Lim, K W.]]
+
== References ==
-
[[Category: Phan, A T.]]
+
<references/>
 +
__TOC__
 +
</StructureSection>
 +
[[Category: Lim, K W]]
 +
[[Category: Phan, A T]]
[[Category: Dna]]
[[Category: Dna]]
[[Category: Duplex]]
[[Category: Duplex]]
[[Category: Quadruplex]]
[[Category: Quadruplex]]
[[Category: Quadruplex-duplex hybrid]]
[[Category: Quadruplex-duplex hybrid]]

Revision as of 12:04, 18 December 2014

Structure of d[GCGCGAAGCATTCGCGGGGAGGTGGGGAAGGG] quadruplex-duplex hybrid

Drag the structure with the mouse to rotate

Proteopedia Page Contributors and Editors (what is this?)

OCA

Personal tools