We apologize for Proteopedia being slow to respond. For the past two years, a new implementation of Proteopedia has been being built. Soon, it will replace this 18-year old system. All existing content will be moved to the new system at a date that will be announced here.

2mo6

From Proteopedia

(Difference between revisions)
Jump to: navigation, search
m (Protected "2mo6" [edit=sysop:move=sysop])
Line 6: Line 6:
Description: G-quadruplex solution structure formed by the sequence d(GGGTTTTGGGTTTTGGGAGGG) in sodium solution
Description: G-quadruplex solution structure formed by the sequence d(GGGTTTTGGGTTTTGGGAGGG) in sodium solution
 +
[[Category: Unreleased Structures]]
 +
[[Category: Karsisiotis, A.I]]
 +
[[Category: Dvorkin, S.A]]
 +
[[Category: Webba Da Silva, M]]

Revision as of 12:13, 24 December 2014

Unreleased structure

The entry 2mo6 is ON HOLD until sometime in the future

Authors: Webba da Silva, M., Dvorkin, S.A., Karsisiotis, A.I.

Description: G-quadruplex solution structure formed by the sequence d(GGGTTTTGGGTTTTGGGAGGG) in sodium solution

Proteopedia Page Contributors and Editors (what is this?)

OCA

Personal tools