We apologize for Proteopedia being slow to respond. For the past two years, a new implementation of Proteopedia has been being built. Soon, it will replace this 18-year old system. All existing content will be moved to the new system at a date that will be announced here.

4ihv

From Proteopedia

(Difference between revisions)
Jump to: navigation, search
Line 7: Line 7:
<tr id='resources'><td class="sblockLbl"><b>Resources:</b></td><td class="sblockDat"><span class='plainlinks'>[http://oca.weizmann.ac.il/oca-docs/fgij/fg.htm?mol=4ihv FirstGlance], [http://oca.weizmann.ac.il/oca-bin/ocaids?id=4ihv OCA], [http://www.rcsb.org/pdb/explore.do?structureId=4ihv RCSB], [http://www.ebi.ac.uk/pdbsum/4ihv PDBsum]</span></td></tr>
<tr id='resources'><td class="sblockLbl"><b>Resources:</b></td><td class="sblockDat"><span class='plainlinks'>[http://oca.weizmann.ac.il/oca-docs/fgij/fg.htm?mol=4ihv FirstGlance], [http://oca.weizmann.ac.il/oca-bin/ocaids?id=4ihv OCA], [http://www.rcsb.org/pdb/explore.do?structureId=4ihv RCSB], [http://www.ebi.ac.uk/pdbsum/4ihv PDBsum]</span></td></tr>
</table>
</table>
 +
== Function ==
 +
[[http://www.uniprot.org/uniprot/C9QXL3_ECOD1 C9QXL3_ECOD1]] Activates ribosomal RNA transcription. Plays a direct role in upstream activation of rRNA promoters (By similarity).[HAMAP-Rule:MF_00166]
<div style="background-color:#fffaf0;">
<div style="background-color:#fffaf0;">
== Publication Abstract from PubMed ==
== Publication Abstract from PubMed ==

Revision as of 19:49, 25 December 2014

Crystal structure of Fis bound to 27 bp sequence DNA F28 (AAATTTGTTTGAGCGTTGAGCAAATTT)

4ihv, resolution 2.72Å

Drag the structure with the mouse to rotate

Proteopedia Page Contributors and Editors (what is this?)

OCA

Personal tools