We apologize for Proteopedia being slow to respond. For the past two years, a new implementation of Proteopedia has been being built. Soon, it will replace this 18-year old system. All existing content will be moved to the new system at a date that will be announced here.
2m6w
From Proteopedia
(Difference between revisions)
| Line 7: | Line 7: | ||
__TOC__ | __TOC__ | ||
</StructureSection> | </StructureSection> | ||
| - | [[Category: Karsisiotis, A I | + | [[Category: Karsisiotis, A I]] |
| - | [[Category: Silva, M Webba da | + | [[Category: Silva, M Webba da]] |
[[Category: Dna]] | [[Category: Dna]] | ||
[[Category: Folding topology]] | [[Category: Folding topology]] | ||
[[Category: G-quadruplex]] | [[Category: G-quadruplex]] | ||
Revision as of 08:14, 25 January 2015
Solution NMR structure of the d(GGGGTTGGGGTTTTGGGGAAGGGG) quadruplex in sodium conditions
| |||||||||||
