2mo6

From Proteopedia

proteopedia linkproteopedia link

Revision as of 12:13, 24 December 2014 (edit) OCA (Talk | contribs) ← Previous diff		Revision as of 10:46, 30 April 2015 (edit) (undo) OCA (Talk | contribs) Next diff →
Line 1:		Line 1:
-	'''Unreleased structure'''	+	WITHDRAWN: The PDB entry 2MO6 was withdrawn.
-		+
-	The entry 2mo6 is ON HOLD until sometime in the future	+
-		+
-	Authors: Webba da Silva, M., Dvorkin, S.A., Karsisiotis, A.I.	+
-		+
-	Description: G-quadruplex solution structure formed by the sequence d(GGGTTTTGGGTTTTGGGAGGG) in sodium solution	+
-	[[Category: Unreleased Structures]]	+
-	[[Category: Karsisiotis, A.I]]	+
-	[[Category: Dvorkin, S.A]]	+
-	[[Category: Webba Da Silva, M]]	+

---

Revision as of 10:46, 30 April 2015

WITHDRAWN: The PDB entry 2MO6 was withdrawn.