From Proteopedia
(Difference between revisions)
proteopedia linkproteopedia link
|
|
| Line 1: |
Line 1: |
| - | '''Unreleased structure'''
| + | WITHDRAWN: The PDB entry 2MO6 was withdrawn. |
| - | | + | |
| - | The entry 2mo6 is ON HOLD until sometime in the future | + | |
| - | | + | |
| - | Authors: Webba da Silva, M., Dvorkin, S.A., Karsisiotis, A.I.
| + | |
| - | | + | |
| - | Description: G-quadruplex solution structure formed by the sequence d(GGGTTTTGGGTTTTGGGAGGG) in sodium solution
| + | |
| - | [[Category: Unreleased Structures]]
| + | |
| - | [[Category: Karsisiotis, A.I]]
| + | |
| - | [[Category: Dvorkin, S.A]]
| + | |
| - | [[Category: Webba Da Silva, M]]
| + | |
Revision as of 10:46, 30 April 2015
WITHDRAWN: The PDB entry 2MO6 was withdrawn.