1qwa
From Proteopedia
(Difference between revisions)
Line 4: | Line 4: | ||
<table><tr><td colspan='2'>[[1qwa]] is a 1 chain structure. Full experimental information is available from [http://oca.weizmann.ac.il/oca-bin/ocashort?id=1QWA OCA]. For a <b>guided tour on the structure components</b> use [http://oca.weizmann.ac.il/oca-docs/fgij/fg.htm?mol=1QWA FirstGlance]. <br> | <table><tr><td colspan='2'>[[1qwa]] is a 1 chain structure. Full experimental information is available from [http://oca.weizmann.ac.il/oca-bin/ocashort?id=1QWA OCA]. For a <b>guided tour on the structure components</b> use [http://oca.weizmann.ac.il/oca-docs/fgij/fg.htm?mol=1QWA FirstGlance]. <br> | ||
</td></tr><tr id='related'><td class="sblockLbl"><b>[[Related_structure|Related:]]</b></td><td class="sblockDat">[[1f7y|1f7y]], [[1jp0|1jp0]], [[1f7f|1f7f]], [[1qwb|1qwb]]</td></tr> | </td></tr><tr id='related'><td class="sblockLbl"><b>[[Related_structure|Related:]]</b></td><td class="sblockDat">[[1f7y|1f7y]], [[1jp0|1jp0]], [[1f7f|1f7f]], [[1qwb|1qwb]]</td></tr> | ||
- | <tr id='resources'><td class="sblockLbl"><b>Resources:</b></td><td class="sblockDat"><span class='plainlinks'>[http://oca.weizmann.ac.il/oca-docs/fgij/fg.htm?mol=1qwa FirstGlance], [http://oca.weizmann.ac.il/oca-bin/ocaids?id=1qwa OCA], [http://www.rcsb.org/pdb/explore.do?structureId=1qwa RCSB], [http://www.ebi.ac.uk/pdbsum/1qwa PDBsum]</span></td></tr> | + | <tr id='resources'><td class="sblockLbl"><b>Resources:</b></td><td class="sblockDat"><span class='plainlinks'>[http://oca.weizmann.ac.il/oca-docs/fgij/fg.htm?mol=1qwa FirstGlance], [http://oca.weizmann.ac.il/oca-bin/ocaids?id=1qwa OCA], [http://pdbe.org/1qwa PDBe], [http://www.rcsb.org/pdb/explore.do?structureId=1qwa RCSB], [http://www.ebi.ac.uk/pdbsum/1qwa PDBsum]</span></td></tr> |
</table> | </table> | ||
<div style="background-color:#fffaf0;"> | <div style="background-color:#fffaf0;"> | ||
Line 14: | Line 14: | ||
From MEDLINE®/PubMed®, a database of the U.S. National Library of Medicine.<br> | From MEDLINE®/PubMed®, a database of the U.S. National Library of Medicine.<br> | ||
</div> | </div> | ||
+ | <div class="pdbe-citations 1qwa" style="background-color:#fffaf0;"></div> | ||
== References == | == References == | ||
<references/> | <references/> |
Revision as of 14:46, 11 September 2015
NMR structure of 5'-r(GGAUGCCUCCCGAGUGCAUCC): an RNA hairpin derived from the mouse 5'ETS that binds nucleolin RBD12.
|
Categories: Feigon, J | Finger, L D | Johansson, C | Trantirek, L | A-form helix | Bulged nucleotide | Hairpin | Rna | Tetraloop | Uncg | Uucg | Ynmg