This old version of Proteopedia is provided for student assignments while the new version is undergoing repairs. Content and edits done in this old version of Proteopedia after March 1, 2026 will eventually be lost when it is retired in about June of 2026.


Apply for new accounts at the new Proteopedia. Your logins will work in both the old and new versions.


5ds9

From Proteopedia

(Difference between revisions)
Jump to: navigation, search

OCA (Talk | contribs)
(New page: '''Unreleased structure''' The entry 5ds9 is ON HOLD until Paper Publication Authors: Hancock, S.P., Cascio, D., Johnson, R.C. Description: Crystal structure of Fis bound to 27bp DNA F...)
Next diff →

Revision as of 13:27, 30 September 2015

Unreleased structure

The entry 5ds9 is ON HOLD until Paper Publication

Authors: Hancock, S.P., Cascio, D., Johnson, R.C.

Description: Crystal structure of Fis bound to 27bp DNA F1-8A (AAATTAGTTTGAATTTTGAGCTAATTT)

Proteopedia Page Contributors and Editors (what is this?)

OCA

Personal tools