We apologize for Proteopedia being slow to respond. For the past two years, a new implementation of Proteopedia has been being built. Soon, it will replace this 18-year old system. All existing content will be moved to the new system at a date that will be announced here.
5ds9
From Proteopedia
(Difference between revisions)
OCA (Talk | contribs)
(New page: '''Unreleased structure''' The entry 5ds9 is ON HOLD until Paper Publication Authors: Hancock, S.P., Cascio, D., Johnson, R.C. Description: Crystal structure of Fis bound to 27bp DNA F...)
Next diff →
Revision as of 13:27, 30 September 2015
Unreleased structure
The entry 5ds9 is ON HOLD until Paper Publication
Authors: Hancock, S.P., Cascio, D., Johnson, R.C.
Description: Crystal structure of Fis bound to 27bp DNA F1-8A (AAATTAGTTTGAATTTTGAGCTAATTT)
