5ds9
From Proteopedia
(Difference between revisions)
m (Protected "5ds9" [edit=sysop:move=sysop]) |
|||
| Line 1: | Line 1: | ||
'''Unreleased structure''' | '''Unreleased structure''' | ||
| - | The entry 5ds9 is ON HOLD until | + | The entry 5ds9 is ON HOLD until sometime in the future |
Authors: Hancock, S.P., Cascio, D., Johnson, R.C. | Authors: Hancock, S.P., Cascio, D., Johnson, R.C. | ||
Revision as of 12:32, 7 October 2015
Unreleased structure
The entry 5ds9 is ON HOLD until sometime in the future
Authors: Hancock, S.P., Cascio, D., Johnson, R.C.
Description: Crystal structure of Fis bound to 27bp DNA F1-8A (AAATTAGTTTGAATTTTGAGCTAATTT)
