5ds9

From Proteopedia

(Difference between revisions)
Jump to: navigation, search
Line 1: Line 1:
'''Unreleased structure'''
'''Unreleased structure'''
-
The entry 5ds9 is ON HOLD until sometime in the future
+
The entry 5ds9 is ON HOLD
Authors: Hancock, S.P., Cascio, D., Johnson, R.C.
Authors: Hancock, S.P., Cascio, D., Johnson, R.C.

Revision as of 02:38, 16 October 2015

Unreleased structure

The entry 5ds9 is ON HOLD

Authors: Hancock, S.P., Cascio, D., Johnson, R.C.

Description: Crystal structure of Fis bound to 27bp DNA F1-8A (AAATTAGTTTGAATTTTGAGCTAATTT)

Proteopedia Page Contributors and Editors (what is this?)

OCA

Personal tools