5e3m

From Proteopedia

(Difference between revisions)
Jump to: navigation, search

OCA (Talk | contribs)
(New page: '''Unreleased structure''' The entry 5e3m is ON HOLD Authors: Stella, S., Hancock, S.P., Cascio, D., Johnson, R.C. Description: Crystal structure of Fis bound to 27bp DNA F35 (AAATTAGT...)
Next diff →

Revision as of 02:56, 16 October 2015

Unreleased structure

The entry 5e3m is ON HOLD

Authors: Stella, S., Hancock, S.P., Cascio, D., Johnson, R.C.

Description: Crystal structure of Fis bound to 27bp DNA F35 (AAATTAGTTTGAATCTCGAGCTAATTT)

Proteopedia Page Contributors and Editors (what is this?)

OCA

Retrieved from "http://52.214.119.220/wiki/index.php/5e3m"
Personal tools