We apologize for Proteopedia being slow to respond. For the past two years, a new implementation of Proteopedia has been being built. Soon, it will replace this 18-year old system. All existing content will be moved to the new system at a date that will be announced here.
5e3m
From Proteopedia
(Difference between revisions)
(New page: '''Unreleased structure''' The entry 5e3m is ON HOLD Authors: Stella, S., Hancock, S.P., Cascio, D., Johnson, R.C. Description: Crystal structure of Fis bound to 27bp DNA F35 (AAATTAGT...) |
m (Protected "5e3m" [edit=sysop:move=sysop]) |
Revision as of 02:56, 16 October 2015
Unreleased structure
The entry 5e3m is ON HOLD
Authors: Stella, S., Hancock, S.P., Cascio, D., Johnson, R.C.
Description: Crystal structure of Fis bound to 27bp DNA F35 (AAATTAGTTTGAATCTCGAGCTAATTT)
