We apologize for Proteopedia being slow to respond. For the past two years, a new implementation of Proteopedia has been being built. Soon, it will replace this 18-year old system. All existing content will be moved to the new system at a date that will be announced here.

5e3o

From Proteopedia

(Difference between revisions)
Jump to: navigation, search
(New page: '''Unreleased structure''' The entry 5e3o is ON HOLD Authors: Hancock, S.P., Cascio, D., Johnson, R.C. Description: Crystal structure of Fis bound to 27bp DNA F32 (AAATTTGGAGGAATTTTCTC...)
m (Protected "5e3o" [edit=sysop:move=sysop])

Revision as of 02:56, 16 October 2015

Unreleased structure

The entry 5e3o is ON HOLD

Authors: Hancock, S.P., Cascio, D., Johnson, R.C.

Description: Crystal structure of Fis bound to 27bp DNA F32 (AAATTTGGAGGAATTTTCTCCAAATTT)

Proteopedia Page Contributors and Editors (what is this?)

OCA

Personal tools