5e3l
From Proteopedia
(Difference between revisions)
m (Protected "5e3l" [edit=sysop:move=sysop]) |
|||
Line 1: | Line 1: | ||
'''Unreleased structure''' | '''Unreleased structure''' | ||
- | The entry 5e3l is ON HOLD | + | The entry 5e3l is ON HOLD until Paper Publication |
Authors: Hancock, S.P., Cascio, D., Johnson, R.C. | Authors: Hancock, S.P., Cascio, D., Johnson, R.C. |
Revision as of 02:23, 1 December 2015
Unreleased structure
The entry 5e3l is ON HOLD until Paper Publication
Authors: Hancock, S.P., Cascio, D., Johnson, R.C.
Description: Crystal structure of Fis bound to 27bp DNA F1-8G (AAATTGGTTTGAATTTTGAGCCAATTT)