5e3m

From Proteopedia

(Difference between revisions)
Jump to: navigation, search
m (Protected "5e3m" [edit=sysop:move=sysop])
Line 1: Line 1:
'''Unreleased structure'''
'''Unreleased structure'''
-
The entry 5e3m is ON HOLD
+
The entry 5e3m is ON HOLD until Paper Publication
Authors: Stella, S., Hancock, S.P., Cascio, D., Johnson, R.C.
Authors: Stella, S., Hancock, S.P., Cascio, D., Johnson, R.C.

Revision as of 02:23, 1 December 2015

Unreleased structure

The entry 5e3m is ON HOLD until Paper Publication

Authors: Stella, S., Hancock, S.P., Cascio, D., Johnson, R.C.

Description: Crystal structure of Fis bound to 27bp DNA F35 (AAATTAGTTTGAATCTCGAGCTAATTT)

Proteopedia Page Contributors and Editors (what is this?)

OCA

Personal tools