This old version of Proteopedia is provided for student assignments while the new version is undergoing repairs. Content and edits done in this old version of Proteopedia after March 1, 2026 will eventually be lost when it is retired in about June of 2026.
Apply for new accounts at the new Proteopedia. Your logins will work in both the old and new versions.
5e3m
From Proteopedia
(Difference between revisions)
| Line 1: | Line 1: | ||
| - | '''Unreleased structure''' | ||
| - | + | ==Crystal structure of Fis bound to 27bp DNA F35 (AAATTAGTTTGAATCTCGAGCTAATTT)== | |
| - | + | <StructureSection load='5e3m' size='340' side='right' caption='[[5e3m]], [[Resolution|resolution]] 2.89Å' scene=''> | |
| - | + | == Structural highlights == | |
| - | + | <table><tr><td colspan='2'>[[5e3m]] is a 4 chain structure. Full crystallographic information is available from [http://oca.weizmann.ac.il/oca-bin/ocashort?id=5E3M OCA]. For a <b>guided tour on the structure components</b> use [http://oca.weizmann.ac.il/oca-docs/fgij/fg.htm?mol=5E3M FirstGlance]. <br> | |
| - | + | </td></tr><tr id='related'><td class="sblockLbl"><b>[[Related_structure|Related:]]</b></td><td class="sblockDat">[[5e3l|5e3l]], [[5e3n|5e3n]], [[5e3o|5e3o]]</td></tr> | |
| - | [[Category: | + | <tr id='resources'><td class="sblockLbl"><b>Resources:</b></td><td class="sblockDat"><span class='plainlinks'>[http://oca.weizmann.ac.il/oca-docs/fgij/fg.htm?mol=5e3m FirstGlance], [http://oca.weizmann.ac.il/oca-bin/ocaids?id=5e3m OCA], [http://pdbe.org/5e3m PDBe], [http://www.rcsb.org/pdb/explore.do?structureId=5e3m RCSB], [http://www.ebi.ac.uk/pdbsum/5e3m PDBsum]</span></td></tr> |
| - | [[Category: Hancock, S | + | </table> |
| + | == Function == | ||
| + | [[http://www.uniprot.org/uniprot/FIS_ECOLI FIS_ECOLI]] Activates ribosomal RNA transcription, as well other genes. Plays a direct role in upstream activation of rRNA promoters. Binds to a recombinational enhancer sequence that is required to stimulate hin-mediated DNA inversion. Prevents initiation of DNA replication from oriC.<ref>PMID:2209559</ref> <ref>PMID:8836178</ref> | ||
| + | == References == | ||
| + | <references/> | ||
| + | __TOC__ | ||
| + | </StructureSection> | ||
| + | [[Category: Cascio, D]] | ||
| + | [[Category: Hancock, S P]] | ||
| + | [[Category: Johnson, R C]] | ||
[[Category: Stella, S]] | [[Category: Stella, S]] | ||
| - | [[Category: | + | [[Category: Dna bending]] |
| - | [[Category: | + | [[Category: Dna binding protein-dna complex]] |
| + | [[Category: Hth domain]] | ||
| + | [[Category: Indirect recognition]] | ||
| + | [[Category: Minor groove compression]] | ||
| + | [[Category: Protein-dna complex]] | ||
Revision as of 03:55, 10 March 2016
Crystal structure of Fis bound to 27bp DNA F35 (AAATTAGTTTGAATCTCGAGCTAATTT)
| |||||||||||
