5e3n
From Proteopedia
(Difference between revisions)
| Line 1: | Line 1: | ||
| - | '''Unreleased structure''' | ||
| - | + | ==Crystal structure of Fis bound to 27bp DNA F31 (AAATTTGTAGGAATTTTCTGCAAATTT)== | |
| - | + | <StructureSection load='5e3n' size='340' side='right' caption='[[5e3n]], [[Resolution|resolution]] 2.66Å' scene=''> | |
| - | + | == Structural highlights == | |
| - | + | <table><tr><td colspan='2'>[[5e3n]] is a 4 chain structure. Full crystallographic information is available from [http://oca.weizmann.ac.il/oca-bin/ocashort?id=5E3N OCA]. For a <b>guided tour on the structure components</b> use [http://oca.weizmann.ac.il/oca-docs/fgij/fg.htm?mol=5E3N FirstGlance]. <br> | |
| - | + | </td></tr><tr id='related'><td class="sblockLbl"><b>[[Related_structure|Related:]]</b></td><td class="sblockDat">[[5e3l|5e3l]], [[5e3o|5e3o]], [[5e3m|5e3m]], [[5ds9|5ds9]], [[5dtd|5dtd]]</td></tr> | |
| - | [[ | + | <tr id='resources'><td class="sblockLbl"><b>Resources:</b></td><td class="sblockDat"><span class='plainlinks'>[http://oca.weizmann.ac.il/oca-docs/fgij/fg.htm?mol=5e3n FirstGlance], [http://oca.weizmann.ac.il/oca-bin/ocaids?id=5e3n OCA], [http://pdbe.org/5e3n PDBe], [http://www.rcsb.org/pdb/explore.do?structureId=5e3n RCSB], [http://www.ebi.ac.uk/pdbsum/5e3n PDBsum]</span></td></tr> |
| - | [[ | + | </table> |
| - | [[ | + | == Function == |
| + | [[http://www.uniprot.org/uniprot/FIS_ECOLI FIS_ECOLI]] Activates ribosomal RNA transcription, as well other genes. Plays a direct role in upstream activation of rRNA promoters. Binds to a recombinational enhancer sequence that is required to stimulate hin-mediated DNA inversion. Prevents initiation of DNA replication from oriC.<ref>PMID:2209559</ref> <ref>PMID:8836178</ref> | ||
| + | == References == | ||
| + | <references/> | ||
| + | __TOC__ | ||
| + | </StructureSection> | ||
[[Category: Cascio, D]] | [[Category: Cascio, D]] | ||
| + | [[Category: Hancock, S P]] | ||
| + | [[Category: Johnson, R C]] | ||
| + | [[Category: Dna bending]] | ||
| + | [[Category: Dna binding protein-dna complex]] | ||
| + | [[Category: Hth domain]] | ||
| + | [[Category: Indirect recognition]] | ||
| + | [[Category: Protein-dna complex]] | ||
Revision as of 03:55, 10 March 2016
Crystal structure of Fis bound to 27bp DNA F31 (AAATTTGTAGGAATTTTCTGCAAATTT)
| |||||||||||
