This old version of Proteopedia is provided for student assignments while the new version is undergoing repairs. Content and edits done in this old version of Proteopedia after March 1, 2026 will eventually be lost when it is retired in about June of 2026.
Apply for new accounts at the new Proteopedia. Your logins will work in both the old and new versions.
4ihv
From Proteopedia
(Difference between revisions)
| Line 1: | Line 1: | ||
| + | |||
==Crystal structure of Fis bound to 27 bp sequence DNA F28 (AAATTTGTTTGAGCGTTGAGCAAATTT)== | ==Crystal structure of Fis bound to 27 bp sequence DNA F28 (AAATTTGTTTGAGCGTTGAGCAAATTT)== | ||
<StructureSection load='4ihv' size='340' side='right' caption='[[4ihv]], [[Resolution|resolution]] 2.72Å' scene=''> | <StructureSection load='4ihv' size='340' side='right' caption='[[4ihv]], [[Resolution|resolution]] 2.72Å' scene=''> | ||
== Structural highlights == | == Structural highlights == | ||
| - | <table><tr><td colspan='2'>[[4ihv]] is a 4 chain structure with sequence from [http://en.wikipedia.org/wiki/ | + | <table><tr><td colspan='2'>[[4ihv]] is a 4 chain structure with sequence from [http://en.wikipedia.org/wiki/Ecoli Ecoli]. Full crystallographic information is available from [http://oca.weizmann.ac.il/oca-bin/ocashort?id=4IHV OCA]. For a <b>guided tour on the structure components</b> use [http://oca.weizmann.ac.il/oca-docs/fgij/fg.htm?mol=4IHV FirstGlance]. <br> |
</td></tr><tr id='related'><td class="sblockLbl"><b>[[Related_structure|Related:]]</b></td><td class="sblockDat">[[4ihw|4ihw]], [[4ihx|4ihx]], [[4ihy|4ihy]]</td></tr> | </td></tr><tr id='related'><td class="sblockLbl"><b>[[Related_structure|Related:]]</b></td><td class="sblockDat">[[4ihw|4ihw]], [[4ihx|4ihx]], [[4ihy|4ihy]]</td></tr> | ||
| - | <tr id='gene'><td class="sblockLbl"><b>[[Gene|Gene:]]</b></td><td class="sblockDat">ECDH1ME8569_3147, EcDH1_0445, fis ([http://www.ncbi.nlm.nih.gov/Taxonomy/Browser/wwwtax.cgi?mode=Info&srchmode=5&id=83333 | + | <tr id='gene'><td class="sblockLbl"><b>[[Gene|Gene:]]</b></td><td class="sblockDat">ECDH1ME8569_3147, EcDH1_0445, fis ([http://www.ncbi.nlm.nih.gov/Taxonomy/Browser/wwwtax.cgi?mode=Info&srchmode=5&id=83333 ECOLI])</td></tr> |
| - | <tr id='resources'><td class="sblockLbl"><b>Resources:</b></td><td class="sblockDat"><span class='plainlinks'>[http://oca.weizmann.ac.il/oca-docs/fgij/fg.htm?mol=4ihv FirstGlance], [http://oca.weizmann.ac.il/oca-bin/ocaids?id=4ihv OCA], [http://www.rcsb.org/pdb/explore.do?structureId=4ihv RCSB], [http://www.ebi.ac.uk/pdbsum/4ihv PDBsum]</span></td></tr> | + | <tr id='resources'><td class="sblockLbl"><b>Resources:</b></td><td class="sblockDat"><span class='plainlinks'>[http://oca.weizmann.ac.il/oca-docs/fgij/fg.htm?mol=4ihv FirstGlance], [http://oca.weizmann.ac.il/oca-bin/ocaids?id=4ihv OCA], [http://pdbe.org/4ihv PDBe], [http://www.rcsb.org/pdb/explore.do?structureId=4ihv RCSB], [http://www.ebi.ac.uk/pdbsum/4ihv PDBsum], [http://prosat.h-its.org/prosat/prosatexe?pdbcode=4ihv ProSAT]</span></td></tr> |
</table> | </table> | ||
== Function == | == Function == | ||
| Line 17: | Line 18: | ||
From MEDLINE®/PubMed®, a database of the U.S. National Library of Medicine.<br> | From MEDLINE®/PubMed®, a database of the U.S. National Library of Medicine.<br> | ||
</div> | </div> | ||
| + | <div class="pdbe-citations 4ihv" style="background-color:#fffaf0;"></div> | ||
==See Also== | ==See Also== | ||
| Line 24: | Line 26: | ||
__TOC__ | __TOC__ | ||
</StructureSection> | </StructureSection> | ||
| - | [[Category: | + | [[Category: Ecoli]] |
[[Category: Cascio, D]] | [[Category: Cascio, D]] | ||
[[Category: Hancock, S P]] | [[Category: Hancock, S P]] | ||
Revision as of 15:07, 5 August 2016
Crystal structure of Fis bound to 27 bp sequence DNA F28 (AAATTTGTTTGAGCGTTGAGCAAATTT)
| |||||||||||
