This old version of Proteopedia is provided for student assignments while the new version is undergoing repairs. Content and edits done in this old version of Proteopedia after March 1, 2026 will eventually be lost when it is retired in about June of 2026.
Apply for new accounts at the new Proteopedia. Your logins will work in both the old and new versions.
5j05
From Proteopedia
(Difference between revisions)
| Line 1: | Line 1: | ||
| - | '''Unreleased structure''' | ||
| - | + | ==DIY G-Quadruplexes: Solution structure of d(GGGTTTGGGTTTTGGGAGGG) in sodium== | |
| - | + | <StructureSection load='5j05' size='340' side='right' caption='[[5j05]], [[NMR_Ensembles_of_Models | 10 NMR models]]' scene=''> | |
| - | + | == Structural highlights == | |
| - | + | <table><tr><td colspan='2'>[[5j05]] is a 1 chain structure. Full experimental information is available from [http://oca.weizmann.ac.il/oca-bin/ocashort?id=5J05 OCA]. For a <b>guided tour on the structure components</b> use [http://oca.weizmann.ac.il/oca-docs/fgij/fg.htm?mol=5J05 FirstGlance]. <br> | |
| - | + | </td></tr><tr id='resources'><td class="sblockLbl"><b>Resources:</b></td><td class="sblockDat"><span class='plainlinks'>[http://oca.weizmann.ac.il/oca-docs/fgij/fg.htm?mol=5j05 FirstGlance], [http://oca.weizmann.ac.il/oca-bin/ocaids?id=5j05 OCA], [http://pdbe.org/5j05 PDBe], [http://www.rcsb.org/pdb/explore.do?structureId=5j05 RCSB], [http://www.ebi.ac.uk/pdbsum/5j05 PDBsum], [http://prosat.h-its.org/prosat/prosatexe?pdbcode=5j05 ProSAT]</span></td></tr> | |
| - | [[Category: | + | </table> |
| + | __TOC__ | ||
| + | </StructureSection> | ||
| + | [[Category: Dvorkin, S A]] | ||
| + | [[Category: Karsisiotis, A I]] | ||
| + | [[Category: Silva, M Webba da]] | ||
| + | [[Category: Dna]] | ||
| + | [[Category: Structure from molmol]] | ||
Revision as of 13:25, 5 April 2017
DIY G-Quadruplexes: Solution structure of d(GGGTTTGGGTTTTGGGAGGG) in sodium
| |||||||||||
