This old version of Proteopedia is provided for student assignments while the new version is undergoing repairs. Content and edits done in this old version of Proteopedia after March 1, 2026 will eventually be lost when it is retired in about June of 2026.


Apply for new accounts at the new Proteopedia. Your logins will work in both the old and new versions.


5j6u

From Proteopedia

(Difference between revisions)
Jump to: navigation, search
Line 1: Line 1:
-
'''Unreleased structure'''
 
-
The entry 5j6u is ON HOLD until Paper Publication
+
==DIY G-Quadruplexes: Solution Structure of d(GGGGTTTGGGGTTTTGGGGAAGGGG) in sodium==
-
 
+
<StructureSection load='5j6u' size='340' side='right' caption='[[5j6u]], [[NMR_Ensembles_of_Models | 11 NMR models]]' scene=''>
-
Authors: Dvorkin, S.A., Karsisiotis, A.I., Webba da Silva, M.
+
== Structural highlights ==
-
 
+
<table><tr><td colspan='2'>[[5j6u]] is a 1 chain structure. Full experimental information is available from [http://oca.weizmann.ac.il/oca-bin/ocashort?id=5J6U OCA]. For a <b>guided tour on the structure components</b> use [http://oca.weizmann.ac.il/oca-docs/fgij/fg.htm?mol=5J6U FirstGlance]. <br>
-
Description: DIY G-Quadruplexes: Solution Structure of d(GGGGTTTGGGGTTTTGGGGAAGGGG) in sodium
+
</td></tr><tr id='resources'><td class="sblockLbl"><b>Resources:</b></td><td class="sblockDat"><span class='plainlinks'>[http://oca.weizmann.ac.il/oca-docs/fgij/fg.htm?mol=5j6u FirstGlance], [http://oca.weizmann.ac.il/oca-bin/ocaids?id=5j6u OCA], [http://pdbe.org/5j6u PDBe], [http://www.rcsb.org/pdb/explore.do?structureId=5j6u RCSB], [http://www.ebi.ac.uk/pdbsum/5j6u PDBsum], [http://prosat.h-its.org/prosat/prosatexe?pdbcode=5j6u ProSAT]</span></td></tr>
-
[[Category: Unreleased Structures]]
+
</table>
-
[[Category: Karsisiotis, A.I]]
+
__TOC__
-
[[Category: Dvorkin, S.A]]
+
</StructureSection>
-
[[Category: Webba Da Silva, M]]
+
[[Category: Dvorkin, S A]]
 +
[[Category: Karsisiotis, A I]]
 +
[[Category: Silva, M Webba da]]
 +
[[Category: Dna]]
 +
[[Category: Programmed design of g-quadruplex folding topology]]
 +
[[Category: Structure from molmol]]

Revision as of 12:55, 10 May 2017

DIY G-Quadruplexes: Solution Structure of d(GGGGTTTGGGGTTTTGGGGAAGGGG) in sodium

Drag the structure with the mouse to rotate

Proteopedia Page Contributors and Editors (what is this?)

OCA

Personal tools