5j6u
From Proteopedia
(Difference between revisions)
| Line 1: | Line 1: | ||
| - | '''Unreleased structure''' | ||
| - | + | ==DIY G-Quadruplexes: Solution Structure of d(GGGGTTTGGGGTTTTGGGGAAGGGG) in sodium== | |
| - | + | <StructureSection load='5j6u' size='340' side='right' caption='[[5j6u]], [[NMR_Ensembles_of_Models | 11 NMR models]]' scene=''> | |
| - | + | == Structural highlights == | |
| - | + | <table><tr><td colspan='2'>[[5j6u]] is a 1 chain structure. Full experimental information is available from [http://oca.weizmann.ac.il/oca-bin/ocashort?id=5J6U OCA]. For a <b>guided tour on the structure components</b> use [http://oca.weizmann.ac.il/oca-docs/fgij/fg.htm?mol=5J6U FirstGlance]. <br> | |
| - | + | </td></tr><tr id='resources'><td class="sblockLbl"><b>Resources:</b></td><td class="sblockDat"><span class='plainlinks'>[http://oca.weizmann.ac.il/oca-docs/fgij/fg.htm?mol=5j6u FirstGlance], [http://oca.weizmann.ac.il/oca-bin/ocaids?id=5j6u OCA], [http://pdbe.org/5j6u PDBe], [http://www.rcsb.org/pdb/explore.do?structureId=5j6u RCSB], [http://www.ebi.ac.uk/pdbsum/5j6u PDBsum], [http://prosat.h-its.org/prosat/prosatexe?pdbcode=5j6u ProSAT]</span></td></tr> | |
| - | [[ | + | </table> |
| - | [[ | + | __TOC__ |
| - | [[Category: Dvorkin, S | + | </StructureSection> |
| - | [[Category: | + | [[Category: Dvorkin, S A]] |
| + | [[Category: Karsisiotis, A I]] | ||
| + | [[Category: Silva, M Webba da]] | ||
| + | [[Category: Dna]] | ||
| + | [[Category: Programmed design of g-quadruplex folding topology]] | ||
| + | [[Category: Structure from molmol]] | ||
Revision as of 12:55, 10 May 2017
DIY G-Quadruplexes: Solution Structure of d(GGGGTTTGGGGTTTTGGGGAAGGGG) in sodium
| |||||||||||
