We apologize for Proteopedia being slow to respond. For the past two years, a new implementation of Proteopedia has been being built. Soon, it will replace this 18-year old system. All existing content will be moved to the new system at a date that will be announced here.
1qwb
From Proteopedia
(Difference between revisions)
| Line 1: | Line 1: | ||
| + | |||
==NMR strucutre of 5'-r(GGACACGAAAUCCCGAAGUAGUGUCC)-3' : an RNA hairpin containing the in vitro selected consensus sequence for nucleolin RBD12== | ==NMR strucutre of 5'-r(GGACACGAAAUCCCGAAGUAGUGUCC)-3' : an RNA hairpin containing the in vitro selected consensus sequence for nucleolin RBD12== | ||
<StructureSection load='1qwb' size='340' side='right' caption='[[1qwb]], [[NMR_Ensembles_of_Models | 17 NMR models]]' scene=''> | <StructureSection load='1qwb' size='340' side='right' caption='[[1qwb]], [[NMR_Ensembles_of_Models | 17 NMR models]]' scene=''> | ||
| Line 4: | Line 5: | ||
<table><tr><td colspan='2'>[[1qwb]] is a 1 chain structure. Full experimental information is available from [http://oca.weizmann.ac.il/oca-bin/ocashort?id=1QWB OCA]. For a <b>guided tour on the structure components</b> use [http://oca.weizmann.ac.il/oca-docs/fgij/fg.htm?mol=1QWB FirstGlance]. <br> | <table><tr><td colspan='2'>[[1qwb]] is a 1 chain structure. Full experimental information is available from [http://oca.weizmann.ac.il/oca-bin/ocashort?id=1QWB OCA]. For a <b>guided tour on the structure components</b> use [http://oca.weizmann.ac.il/oca-docs/fgij/fg.htm?mol=1QWB FirstGlance]. <br> | ||
</td></tr><tr id='related'><td class="sblockLbl"><b>[[Related_structure|Related:]]</b></td><td class="sblockDat">[[1ie1|1ie1]], [[1ie2|1ie2]], [[1qwa|1qwa]]</td></tr> | </td></tr><tr id='related'><td class="sblockLbl"><b>[[Related_structure|Related:]]</b></td><td class="sblockDat">[[1ie1|1ie1]], [[1ie2|1ie2]], [[1qwa|1qwa]]</td></tr> | ||
| - | <tr id='resources'><td class="sblockLbl"><b>Resources:</b></td><td class="sblockDat"><span class='plainlinks'>[http://oca.weizmann.ac.il/oca-docs/fgij/fg.htm?mol=1qwb FirstGlance], [http://oca.weizmann.ac.il/oca-bin/ocaids?id=1qwb OCA], [http://pdbe.org/1qwb PDBe], [http://www.rcsb.org/pdb/explore.do?structureId=1qwb RCSB], [http://www.ebi.ac.uk/pdbsum/1qwb PDBsum]</span></td></tr> | + | <tr id='resources'><td class="sblockLbl"><b>Resources:</b></td><td class="sblockDat"><span class='plainlinks'>[http://oca.weizmann.ac.il/oca-docs/fgij/fg.htm?mol=1qwb FirstGlance], [http://oca.weizmann.ac.il/oca-bin/ocaids?id=1qwb OCA], [http://pdbe.org/1qwb PDBe], [http://www.rcsb.org/pdb/explore.do?structureId=1qwb RCSB], [http://www.ebi.ac.uk/pdbsum/1qwb PDBsum], [http://prosat.h-its.org/prosat/prosatexe?pdbcode=1qwb ProSAT]</span></td></tr> |
</table> | </table> | ||
<div style="background-color:#fffaf0;"> | <div style="background-color:#fffaf0;"> | ||
Revision as of 07:54, 28 February 2018
NMR strucutre of 5'-r(GGACACGAAAUCCCGAAGUAGUGUCC)-3' : an RNA hairpin containing the in vitro selected consensus sequence for nucleolin RBD12
| |||||||||||
