We apologize for Proteopedia being slow to respond. For the past two years, a new implementation of Proteopedia has been being built. Soon, it will replace this 18-year old system. All existing content will be moved to the new system at a date that will be announced here.

5j6u

From Proteopedia

(Difference between revisions)
Jump to: navigation, search
Line 6: Line 6:
</td></tr><tr id='resources'><td class="sblockLbl"><b>Resources:</b></td><td class="sblockDat"><span class='plainlinks'>[http://oca.weizmann.ac.il/oca-docs/fgij/fg.htm?mol=5j6u FirstGlance], [http://oca.weizmann.ac.il/oca-bin/ocaids?id=5j6u OCA], [http://pdbe.org/5j6u PDBe], [http://www.rcsb.org/pdb/explore.do?structureId=5j6u RCSB], [http://www.ebi.ac.uk/pdbsum/5j6u PDBsum], [http://prosat.h-its.org/prosat/prosatexe?pdbcode=5j6u ProSAT]</span></td></tr>
</td></tr><tr id='resources'><td class="sblockLbl"><b>Resources:</b></td><td class="sblockDat"><span class='plainlinks'>[http://oca.weizmann.ac.il/oca-docs/fgij/fg.htm?mol=5j6u FirstGlance], [http://oca.weizmann.ac.il/oca-bin/ocaids?id=5j6u OCA], [http://pdbe.org/5j6u PDBe], [http://www.rcsb.org/pdb/explore.do?structureId=5j6u RCSB], [http://www.ebi.ac.uk/pdbsum/5j6u PDBsum], [http://prosat.h-its.org/prosat/prosatexe?pdbcode=5j6u ProSAT]</span></td></tr>
</table>
</table>
 +
<div style="background-color:#fffaf0;">
 +
== Publication Abstract from PubMed ==
 +
The main challenge in DNA quadruplex design is to encode a three-dimensional structure into the primary sequence, despite its multiple, repetitive guanine segments. We identify and detail structural elements describing all 14 feasible canonical quadruplex scaffolds and demonstrate their use in control of design. This work outlines a new roadmap for implementation of targeted design of quadruplexes for material, biotechnological, and therapeutic applications.
 +
 +
Encoding canonical DNA quadruplex structure.,Dvorkin SA, Karsisiotis AI, Webba da Silva M Sci Adv. 2018 Aug 31;4(8):eaat3007. doi: 10.1126/sciadv.aat3007. eCollection 2018, Aug. PMID:30182059<ref>PMID:30182059</ref>
 +
 +
From MEDLINE&reg;/PubMed&reg;, a database of the U.S. National Library of Medicine.<br>
 +
</div>
 +
<div class="pdbe-citations 5j6u" style="background-color:#fffaf0;"></div>
 +
== References ==
 +
<references/>
__TOC__
__TOC__
</StructureSection>
</StructureSection>

Revision as of 08:21, 10 October 2018

DIY G-Quadruplexes: Solution Structure of d(GGGGTTTGGGGTTTTGGGGAAGGGG) in sodium

Drag the structure with the mouse to rotate

Proteopedia Page Contributors and Editors (what is this?)

OCA

Personal tools