We apologize for Proteopedia being slow to respond. For the past two years, a new implementation of Proteopedia has been being built. Soon, it will replace this 18-year old system. All existing content will be moved to the new system at a date that will be announced here.

6gh0

From Proteopedia

(Difference between revisions)
Jump to: navigation, search
m (Protected "6gh0" [edit=sysop:move=sysop])
Line 1: Line 1:
-
'''Unreleased structure'''
 
-
The entry 6gh0 is ON HOLD
+
==Two-quartet kit* G-quadruplex is formed via double-stranded pre-folded structure==
 +
<StructureSection load='6gh0' size='340' side='right' caption='[[6gh0]], [[NMR_Ensembles_of_Models | 10 NMR models]]' scene=''>
 +
== Structural highlights ==
 +
<table><tr><td colspan='2'>[[6gh0]] is a 1 chain structure. Full experimental information is available from [http://oca.weizmann.ac.il/oca-bin/ocashort?id=6GH0 OCA]. For a <b>guided tour on the structure components</b> use [http://oca.weizmann.ac.il/oca-docs/fgij/fg.htm?mol=6GH0 FirstGlance]. <br>
 +
</td></tr><tr id='resources'><td class="sblockLbl"><b>Resources:</b></td><td class="sblockDat"><span class='plainlinks'>[http://oca.weizmann.ac.il/oca-docs/fgij/fg.htm?mol=6gh0 FirstGlance], [http://oca.weizmann.ac.il/oca-bin/ocaids?id=6gh0 OCA], [http://pdbe.org/6gh0 PDBe], [http://www.rcsb.org/pdb/explore.do?structureId=6gh0 RCSB], [http://www.ebi.ac.uk/pdbsum/6gh0 PDBsum], [http://prosat.h-its.org/prosat/prosatexe?pdbcode=6gh0 ProSAT]</span></td></tr>
 +
</table>
 +
<div style="background-color:#fffaf0;">
 +
== Publication Abstract from PubMed ==
 +
In the promoter of c-KIT proto-oncogene, whose deregulation has been implicated in many cancers, three G-rich regions (kit1, kit* and kit2) are able to fold into G-quadruplexes. While kit1 and kit2 have been studied in depth, little information is available on kit* folding behavior despite its key role in regulation of c-KIT transcription. Notably, kit* contains consensus sites for SP1 and AP2 transcription factors. Herein, a set of complementary spectroscopic and biophysical methods reveals that kit*, d[GGCGAGGAGGGGCGTGGCCGGC], adopts a chair type antiparallel G-quadruplex with two G-quartets at physiological relevant concentrations of KCl. Heterogeneous ensemble of structures is observed in the presence of Na+ and NH4+ ions, which however stabilize pre-folded structure. In the presence of K+ ions stacking interactions of adenine and thymine residues on the top G-quartet contribute to structural stability together with a G10*C18 base pair and a fold-back motif of the five residues at the 3'-terminal under the bottom G-quartet. The 3'-tail enables formation of a bimolecular pre-folded structure that drives folding of kit* into a single G-quadruplex. Intriguingly, kinetics of kit* G-quadruplex formation matches timescale of transcriptional processes and might demonstrate interplay of kinetic and thermodynamic factors for understanding regulation of c-KIT proto-oncogene expression.
-
Authors:
+
Two-quartet kit* G-quadruplex is formed via double-stranded pre-folded structure.,Kotar A, Rigo R, Sissi C, Plavec J Nucleic Acids Res. 2018 Dec 21. pii: 5257350. doi: 10.1093/nar/gky1269. PMID:30590801<ref>PMID:30590801</ref>
-
Description:
+
From MEDLINE&reg;/PubMed&reg;, a database of the U.S. National Library of Medicine.<br>
-
[[Category: Unreleased Structures]]
+
</div>
 +
<div class="pdbe-citations 6gh0" style="background-color:#fffaf0;"></div>
 +
== References ==
 +
<references/>
 +
__TOC__
 +
</StructureSection>
 +
[[Category: Kotar, A]]
 +
[[Category: Plavec, J]]
 +
[[Category: Rigo, R]]
 +
[[Category: Sissi, C]]
 +
[[Category: C-kit promoter]]
 +
[[Category: Dna]]
 +
[[Category: G-quadruplex]]
 +
[[Category: Two g-quartet]]

Revision as of 06:36, 9 January 2019

Two-quartet kit* G-quadruplex is formed via double-stranded pre-folded structure

Drag the structure with the mouse to rotate

Proteopedia Page Contributors and Editors (what is this?)

OCA

Personal tools