We apologize for Proteopedia being slow to respond. For the past two years, a new implementation of Proteopedia has been being built. Soon, it will replace this 18-year old system. All existing content will be moved to the new system at a date that will be announced here.

1qwb

From Proteopedia

(Difference between revisions)
Jump to: navigation, search
Line 1: Line 1:
==NMR strucutre of 5'-r(GGACACGAAAUCCCGAAGUAGUGUCC)-3' : an RNA hairpin containing the in vitro selected consensus sequence for nucleolin RBD12==
==NMR strucutre of 5'-r(GGACACGAAAUCCCGAAGUAGUGUCC)-3' : an RNA hairpin containing the in vitro selected consensus sequence for nucleolin RBD12==
-
<StructureSection load='1qwb' size='340' side='right' caption='[[1qwb]], [[NMR_Ensembles_of_Models | 17 NMR models]]' scene=''>
+
<StructureSection load='1qwb' size='340' side='right'caption='[[1qwb]], [[NMR_Ensembles_of_Models | 17 NMR models]]' scene=''>
== Structural highlights ==
== Structural highlights ==
<table><tr><td colspan='2'>[[1qwb]] is a 1 chain structure. Full experimental information is available from [http://oca.weizmann.ac.il/oca-bin/ocashort?id=1QWB OCA]. For a <b>guided tour on the structure components</b> use [http://oca.weizmann.ac.il/oca-docs/fgij/fg.htm?mol=1QWB FirstGlance]. <br>
<table><tr><td colspan='2'>[[1qwb]] is a 1 chain structure. Full experimental information is available from [http://oca.weizmann.ac.il/oca-bin/ocashort?id=1QWB OCA]. For a <b>guided tour on the structure components</b> use [http://oca.weizmann.ac.il/oca-docs/fgij/fg.htm?mol=1QWB FirstGlance]. <br>
Line 20: Line 20:
__TOC__
__TOC__
</StructureSection>
</StructureSection>
 +
[[Category: Large Structures]]
[[Category: Feigon, J]]
[[Category: Feigon, J]]
[[Category: Finger, L D]]
[[Category: Finger, L D]]

Revision as of 11:30, 4 December 2019

NMR strucutre of 5'-r(GGACACGAAAUCCCGAAGUAGUGUCC)-3' : an RNA hairpin containing the in vitro selected consensus sequence for nucleolin RBD12

PDB ID 1qwb

Drag the structure with the mouse to rotate

Proteopedia Page Contributors and Editors (what is this?)

OCA

Personal tools