1qwb
From Proteopedia
(Difference between revisions)
| Line 1: | Line 1: | ||
==NMR strucutre of 5'-r(GGACACGAAAUCCCGAAGUAGUGUCC)-3' : an RNA hairpin containing the in vitro selected consensus sequence for nucleolin RBD12== | ==NMR strucutre of 5'-r(GGACACGAAAUCCCGAAGUAGUGUCC)-3' : an RNA hairpin containing the in vitro selected consensus sequence for nucleolin RBD12== | ||
| - | <StructureSection load='1qwb' size='340' side='right' caption='[[1qwb]], [[NMR_Ensembles_of_Models | 17 NMR models]]' scene=''> | + | <StructureSection load='1qwb' size='340' side='right'caption='[[1qwb]], [[NMR_Ensembles_of_Models | 17 NMR models]]' scene=''> |
== Structural highlights == | == Structural highlights == | ||
<table><tr><td colspan='2'>[[1qwb]] is a 1 chain structure. Full experimental information is available from [http://oca.weizmann.ac.il/oca-bin/ocashort?id=1QWB OCA]. For a <b>guided tour on the structure components</b> use [http://oca.weizmann.ac.il/oca-docs/fgij/fg.htm?mol=1QWB FirstGlance]. <br> | <table><tr><td colspan='2'>[[1qwb]] is a 1 chain structure. Full experimental information is available from [http://oca.weizmann.ac.il/oca-bin/ocashort?id=1QWB OCA]. For a <b>guided tour on the structure components</b> use [http://oca.weizmann.ac.il/oca-docs/fgij/fg.htm?mol=1QWB FirstGlance]. <br> | ||
| Line 20: | Line 20: | ||
__TOC__ | __TOC__ | ||
</StructureSection> | </StructureSection> | ||
| + | [[Category: Large Structures]] | ||
[[Category: Feigon, J]] | [[Category: Feigon, J]] | ||
[[Category: Finger, L D]] | [[Category: Finger, L D]] | ||
Revision as of 11:30, 4 December 2019
NMR strucutre of 5'-r(GGACACGAAAUCCCGAAGUAGUGUCC)-3' : an RNA hairpin containing the in vitro selected consensus sequence for nucleolin RBD12
| |||||||||||
